| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-8055 |
| Genomic Coordinates | chr8: 6622124 - 6622220 |
| Description | Homo sapiens miR-8055 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-8055 | |||||||||||||||||||||||||||
| Sequence | 65| CUUUGAGCACAUGAGCAGACGGA |87 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | LZIC | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | leucine zipper and CTNNBIP1 domain containing | ||||||||||||||||||||
| Transcript | NM_032368 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on LZIC | |||||||||||||||||||||
| 3'UTR of LZIC (miRNA target sites are highlighted) |
>LZIC|NM_032368|3'UTR 1 CATGGTGCAGAAGCTTGTAACATTGATCACATTCTTAATGTAAATGGTGTCTTTCTTCTGGGGTTTTCAGTTATTGCAAA 81 GAAATGAAGAGATTCTGGAAATGCATCAATAACCTAAGAAAAAGCGACATAAAAATATACTTATGGCTTGTGTTTATGCT 161 CTTCATCATTGTGCGTTGTGTGCGGTTACCTGCTTGAGTGATCCTGAACTTGTTGCGACAGAGGGACTCACTGGACTCTG 241 TTCGTTATGATTTGTCTGTTTAAGAGAGAAAACAAAGTGGACTTGATTTTTATTAAGGCTGTTTGTTTTTAAGTGTTGAT 321 AGTGAACGAAAAGATGTGAAGTAATGATATTTTTCTGCTTACAACTTATCCCCACTCATTGGAGTGAACAGTGACGCAAG 401 CTCAATAGACTTCATAAGTGTTCATAGAATTTTACAATTCTGAGTGATCTTAGAAATCATTTCTGTTTTTACAAACAAGG 481 AAACTGAGGTCCAGAAAGAGCAAGCGACTTTGCTTAAAGTCGCATCAGAGAGCTGAGGGTAAGACTCAGGTGTCCTGACT 561 CCCAGTTTAGTATCTTTTGAATTTTATTTCTGTACCATTTAAAAAAAATAATTAACACTATTTGTGCAAGTCAGTGTTTT 641 TGAAAATTCAGTGTCCCAATAAAAAGTGGACTGCACACTAAGGGACCATCCCCCAGCCTGTAAGCTGTCTGTATTAATGG 721 GGCCCGTTGTATCTCGGAATTTTGAGGTTGGAACAATGGGAGCCCTGTTGAGCGTTTCCTAAAGTGACTTAGCCGCCTGC 801 GTTGTTTGACCAGGGAAGCAACAGGAAATGGCAGCTAGAGGCCCTCCCTGTGCGTGACCTCTTGTCACACTCAGAGGGGG 881 GTAACTGTCAGCTGTTATCTACTCTTCAGGTTTTGGAGAAACACAAAATAAGTTATGAGGAAAAGCAAATTTCTCTCCTG 961 AGTATTTACATGTCTCTGTATGCTCAAATATGCAGATGTGTCCCTATGCGTGTATATTAGCTTATTTTTTAGGCTCTAGC 1041 CATTTTATATTCTTTCATGTGCTTCTCAATATTCTTTTTCTTTGCACTTTATACAAATTAAAAGCATTTTTAAAGCTTCT 1121 TCTGTACTGTAAACTACTAGGTGCTTTGCCAACCAGACAGATTAGAGGACCTCCGCTACACTGATGCCTTATTTGGAACT 1201 TAAAAGAGGTGAAATTCATATATCATAAAATTCACCATTTTAAAGTGTACCATTCGTTGGCAGAACATTTACAGTGGTGT 1281 GCAACCATCACTACTCTCTAGTTGCAGAACATTCTTATCACCCCCAAAGGAGGCCCTATACCTATTAAGCAGTTAGTCCC 1361 CATTCCCTTCTCCTCCGACTGCTAACAATAGCCACTAATCTGCACCCTGTCTCTGTGGATTTACCTATTCTGGATATTTC 1441 ATATAAATGGAATCATATGATATGTGACCTTTTTATGTATCTGGCTTCTTTCACTTAGCATAATATTTTCTTTTCTTTTT 1521 TTTTTTTTTTTTGAGACAGAGTTTTACTCTTATTGCCCAGGCTGGAGTGCAATGGCGCAATCTCAACCTCCGCCTCCCAG 1601 GTTCAAGAGATTCTCCTGCCTCAGCTTCCCAAGTAGCTGGGATTACTAGTGTGTACCACCACGCCCAGCTAATTTTTGTA 1681 CCTTTAGTATAGAGACAGGGTTTCACCATGTTGGCCCAGCTGGTCCTGAGCTGACCTCAGGTGATCCAACTGCCTCGGCC 1761 TCCCAAAGTGCTGGGATTATAGGTGTGAGCTACCACACCGGGACATCATCATATTTTCAAGTTTAACCAACATTATAGCA 1841 TGTATCAGTACTTTATTCCTTTTTATGGCTAAATAATATTCCATTGTATGGATATCATATTTTGTTTATCCGGTATCTGT 1921 TGATGATTTGGGTTGTTTCCTTCTTTTGGCTATTGTGAATAATGCTTCAGTGAACATTTGTGTACAAATATTTGTTTGAA 2001 TACCTGTTTTCAATTTTTTTGGGTGTACACCTAGGAATGGAATTGCTGCGTTTGTTGTTGTGTTGTTGTTGTTGTCGTTG 2081 TTTTTTGAGATGGAGTTTCACTCTGTTGCCCAGGCTGGAGTGCAATGGCGTGATCTCGGCTCACCACAACTTCTGCCTCC 2161 CAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTAAGGCATGCGCCACCACACCTGGCTAATTTTGT 2241 GTTTTTAGTAGAGATGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTTAGGTGATCCACCCGCCTCAA 2321 CCTCCCAGAGTGCTGGGATGATTACAGGCATGAGCCACCATACCCGGCCTGAGCCACCACACCCAGCCTACGTTTGTTTT 2401 TTAAGCCATAGAAGATTCTTCCCACCAGTCGGGCACAGTGGCTCACACCTGTAATCCCAGCACTTCAGGAGGCCAAGGCG 2481 GGCGGATCACAAGATCAGGAGCTCAAGACCAGCCTGGCCAACACAGTGAAACTCCATCTCTACAAAAATTAGCCAGGCAT 2561 AGTGGCAGGTGCCTGTAGTCTCAGCTACTTGGGAGACTGAGGCAGGAGAATCACTTGAACCTGGGAGGCAGAGGTTTCGG 2641 TGAGCCGAGATGGCGCCACTGCACTCCAGCCTGGGCGACAGACTGAGACACGGTCTCAAAAAAAAAAAAAAAAAAAAAAA 2721 GAGGAAGAAGATTCTTCCCTTACCCTGCAATAGTAGACCAGAAAAATTAGGAATATCTTGAATTTGAAAGGGACCTAATG 2801 CCTGGCACAGTGGCTCACGCATGTAATCTCAGAACTCTGGGAGGCAGAGGTGGGCGGATCGCCTGAACTCAGGATTTGAG 2881 ACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTAAAAAAAAAAAAAAAATTAGCCAGGCGTGATGGCATGCACTTGTGG 2961 TCCCAGCTACTCAGGAAGCTGAGGTCAGAGGATCACCTGAACCTGGGAAGCAGAGGTTGCAGTGAACTGAGATCACGCCA 3041 CTGTACTGGCTGACAAAGTGAGACCCCTGTCTAAAAAAAAGATAAAGAGAGTTACCTGAATCTGGAATCCTTAATCTTGG 3121 TTTTCCTTAAACTTTCTATAAGTCCAGCATCTGAAATATTTTGTCAATTATCACATTAATGTGTTCATTTTGTAAGTAAG 3201 AGTACTCAATTTAAAATGATCTTACTTTAAAAGTGGCCTAGTTTGCAGTGCCCAGCAGGACACTGACAGTCACAGCTGTG 3281 TGACTTTTTGTGGGTTACTTAATTTTTTTGAGCCTCCTTTTCTCTTCTATTCAATGAGGATAATAGGGCCTACCTCATAG 3361 GATTATTATGCATTCCCCTCTGTTAATGCACGTAAAGTTTTTACTTGGAAAACTAACTCACCATTTAACAACCATTCTAA 3441 GCACCATAGGATATATTTTGTTTCACAAATTTGGTATTCATTCAGAATAAGTATTTGAAAAGTGAGTAAATTCTATGCAA 3521 TTATAGTTATTAAATGACTTATAAACTGTGTTTCTCTTCCACTTCTTGCTACATTTAATCTTCTAGGTGTTCAGATATCT 3601 TTGGAGATTATAGGCAGCAATAAAGCTAAGGCAGCTAACCTTTCAACATTCTTGTGTCAGGCTAATATTTTGGTGAAAGG 3681 AATTCTTGTGTTTCTCAAAGAACTAGAGCTGAAGCAGAAATAAGTTCCAATGAGCAAGTGTCCAATCGGACCATTGAATG 3761 AAATCTAGTGTTTTAAACAATTCTGATGTTTCAATGTTTTGTTCTGTTTTCTTTTGATCTTGTGAGCAGTAAGACATATT 3841 TTATGTGGGTGGTAAAGGAAGAAATCAAGTAACAGAATGAGGAATTGTTCCCAGGAAGAGTTAGAGTTGGGACAAATGGG 3921 TTGTTAACTTTGATTTTTAGATCTTCTCTGAAGACATTAAACATGGAATGGTCATCTTTAGAAAAATAAAAGACTATGCA 4001 ACTCCACCACTGAAATGGTATCTTATTACAGTGAATGATGGATAATCTGAAATTACTATAGAAAAAAATAAACCCAGACC 4081 ATTTTGCCTAGAGCCTTTCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 84328.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293S |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
| Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM1084065 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
| Location of target site | ENST00000377223.1 | 3UTR | CACGGUCUCAAAAAAAAAAAAAA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23824327 / GSE44404 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000377223.1 | 3UTR | GACUGAGACACGGUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000377223.1 | 3UTR | AGACUGAGACACGGUCUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000377223.1 | 3UTR | AGACUGAGACACGGUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000377223.1 | 3UTR | GACUGAGACACGGUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
192 hsa-miR-8055 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT104178 | PHTF2 | putative homeodomain transcription factor 2 |  |
|
2 | 6 | ||||||
| MIRT109489 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT138601 | HIF1A | hypoxia inducible factor 1 alpha subunit | |
|
2 | 2 | ||||||
| MIRT207609 | COX5B | cytochrome c oxidase subunit 5B | |
|
2 | 2 | ||||||
| MIRT246311 | HIST2H2AA3 | histone cluster 2 H2A family member a3 | |
|
2 | 4 | ||||||
| MIRT246323 | HIST2H2AA4 | histone cluster 2 H2A family member a4 | |
|
2 | 4 | ||||||
| MIRT267508 | FEN1 | flap structure-specific endonuclease 1 | |
|
2 | 2 | ||||||
| MIRT271002 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | |
|
2 | 2 | ||||||
| MIRT378038 | SMAD5 | SMAD family member 5 | |
|
2 | 4 | ||||||
| MIRT442382 | CLVS2 | clavesin 2 | |
|
2 | 2 | ||||||
| MIRT443996 | METRN | meteorin, glial cell differentiation regulator | |
|
2 | 4 | ||||||
| MIRT444222 | TMEM136 | transmembrane protein 136 | |
|
2 | 2 | ||||||
| MIRT445870 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | |
|
2 | 2 | ||||||
| MIRT463214 | ZNF131 | zinc finger protein 131 | |
|
2 | 2 | ||||||
| MIRT464523 | UBXN2B | UBX domain protein 2B | |
|
2 | 2 | ||||||
| MIRT471509 | PCGF3 | polycomb group ring finger 3 | |
|
2 | 6 | ||||||
| MIRT474035 | LONRF1 | LON peptidase N-terminal domain and ring finger 1 | |
|
2 | 2 | ||||||
| MIRT481566 | ARIH2 | ariadne RBR E3 ubiquitin protein ligase 2 | |
|
2 | 2 | ||||||
| MIRT485415 | LZIC | leucine zipper and CTNNBIP1 domain containing | |
|
2 | 8 | ||||||
| MIRT485724 | CALM2 | calmodulin 2 | |
|
2 | 2 | ||||||
| MIRT500745 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 2 | ||||||
| MIRT502790 | CELSR3 | cadherin EGF LAG seven-pass G-type receptor 3 | |
|
2 | 6 | ||||||
| MIRT503164 | AGO2 | argonaute 2, RISC catalytic component | |
|
2 | 4 | ||||||
| MIRT504842 | HAUS3 | HAUS augmin like complex subunit 3 | |
|
2 | 6 | ||||||
| MIRT506559 | MNX1 | motor neuron and pancreas homeobox 1 | |
|
2 | 4 | ||||||
| MIRT511372 | IKZF3 | IKAROS family zinc finger 3 | |
|
2 | 6 | ||||||
| MIRT522117 | NUDT3 | nudix hydrolase 3 | |
|
2 | 4 | ||||||
| MIRT523755 | FBXO27 | F-box protein 27 | |
|
2 | 4 | ||||||
| MIRT525160 | PGPEP1 | pyroglutamyl-peptidase I | |
|
2 | 4 | ||||||
| MIRT537294 | FZD5 | frizzled class receptor 5 | |
|
2 | 2 | ||||||
| MIRT537493 | FAM168B | family with sequence similarity 168 member B | |
|
2 | 2 | ||||||
| MIRT538375 | CRIM1 | cysteine rich transmembrane BMP regulator 1 | |
|
2 | 2 | ||||||
| MIRT539394 | ADO | 2-aminoethanethiol dioxygenase | |
|
2 | 2 | ||||||
| MIRT544124 | PPIL1 | peptidylprolyl isomerase like 1 | |
|
2 | 2 | ||||||
| MIRT547269 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT548034 | GOLIM4 | golgi integral membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT551641 | CCDC127 | coiled-coil domain containing 127 | |
|
2 | 2 | ||||||
| MIRT552585 | ZCCHC9 | zinc finger CCHC-type containing 9 | |
|
2 | 2 | ||||||
| MIRT552605 | ZBTB8A | zinc finger and BTB domain containing 8A | |
|
2 | 2 | ||||||
| MIRT554174 | SLC35E2B | solute carrier family 35 member E2B | |
|
2 | 2 | ||||||
| MIRT556914 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | |
|
2 | 2 | ||||||
| MIRT564288 | MED26 | mediator complex subunit 26 | |
|
2 | 2 | ||||||
| MIRT571375 | TTPAL | alpha tocopherol transfer protein like | |
|
2 | 4 | ||||||
| MIRT572009 | HIC2 | HIC ZBTB transcriptional repressor 2 | |
|
2 | 2 | ||||||
| MIRT572339 | CKAP2L | cytoskeleton associated protein 2 like | |
|
2 | 4 | ||||||
| MIRT572612 | CNTLN | centlein | |
|
2 | 2 | ||||||
| MIRT572779 | ZNF277 | zinc finger protein 277 | |
|
2 | 2 | ||||||
| MIRT573258 | DCAF10 | DDB1 and CUL4 associated factor 10 | |
|
2 | 2 | ||||||
| MIRT573353 | PDE3A | phosphodiesterase 3A | |
|
2 | 4 | ||||||
| MIRT573362 | MAP2K6 | mitogen-activated protein kinase kinase 6 | |
|
2 | 2 | ||||||
| MIRT574194 | LMNB1 | lamin B1 | |
|
2 | 2 | ||||||
| MIRT574453 | RPS16 | ribosomal protein S16 | |
|
2 | 2 | ||||||
| MIRT574849 | C12orf73 | chromosome 12 open reading frame 73 | |
|
2 | 2 | ||||||
| MIRT575356 | Zxda | zinc finger, X-linked, duplicated A | |
|
2 | 3 | ||||||
| MIRT612192 | CCDC77 | coiled-coil domain containing 77 | |
|
2 | 2 | ||||||
| MIRT612974 | GGCX | gamma-glutamyl carboxylase | |
|
2 | 2 | ||||||
| MIRT613749 | UNKL | unkempt family like zinc finger | |
|
2 | 2 | ||||||
| MIRT614085 | PDE4C | phosphodiesterase 4C | |
|
2 | 2 | ||||||
| MIRT614405 | ADAT1 | adenosine deaminase, tRNA specific 1 | |
|
2 | 2 | ||||||
| MIRT614441 | WDR92 | WD repeat domain 92 | |
|
2 | 2 | ||||||
| MIRT614518 | SUB1 | SUB1 homolog, transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT614653 | NIPAL3 | NIPA like domain containing 3 | |
|
2 | 2 | ||||||
| MIRT614720 | TEAD3 | TEA domain transcription factor 3 | |
|
2 | 2 | ||||||
| MIRT615556 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT616636 | LRAT | lecithin retinol acyltransferase | |
|
2 | 4 | ||||||
| MIRT617210 | CERS4 | ceramide synthase 4 | |
|
2 | 2 | ||||||
| MIRT618934 | SF3A3 | splicing factor 3a subunit 3 | |
|
2 | 2 | ||||||
| MIRT619995 | C1orf64 | steroid receptor associated and regulated protein | |
|
2 | 2 | ||||||
| MIRT620819 | MKI67IP | nucleolar protein interacting with the FHA domain of MKI67 | |
1 | 1 | |||||||
| MIRT621254 | PDZD2 | PDZ domain containing 2 | |
|
2 | 2 | ||||||
| MIRT622307 | SETD5 | SET domain containing 5 | |
|
2 | 2 | ||||||
| MIRT623324 | MAN1C1 | mannosidase alpha class 1C member 1 | |
|
2 | 2 | ||||||
| MIRT625066 | ACSM2A | acyl-CoA synthetase medium chain family member 2A | |
|
2 | 2 | ||||||
| MIRT625443 | RANGAP1 | Ran GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT626182 | SRFBP1 | serum response factor binding protein 1 | |
|
2 | 2 | ||||||
| MIRT626701 | TRIM65 | tripartite motif containing 65 | |
|
2 | 2 | ||||||
| MIRT628925 | TBRG4 | transforming growth factor beta regulator 4 | |
|
2 | 2 | ||||||
| MIRT630883 | SLC25A33 | solute carrier family 25 member 33 | |
|
2 | 2 | ||||||
| MIRT631653 | BRI3BP | BRI3 binding protein | |
|
2 | 2 | ||||||
| MIRT631696 | C1QTNF6 | C1q and TNF related 6 | |
|
2 | 2 | ||||||
| MIRT632864 | GSPT1 | G1 to S phase transition 1 | |
|
2 | 2 | ||||||
| MIRT635185 | NFKBID | NFKB inhibitor delta | |
|
2 | 2 | ||||||
| MIRT636917 | ZNF845 | zinc finger protein 845 | |
|
2 | 2 | ||||||
| MIRT637048 | RAB27A | RAB27A, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT637599 | ZNF554 | zinc finger protein 554 | |
|
2 | 2 | ||||||
| MIRT638204 | SPTLC2 | serine palmitoyltransferase long chain base subunit 2 | |
|
2 | 2 | ||||||
| MIRT638839 | CPE | carboxypeptidase E | |
|
2 | 2 | ||||||
| MIRT639005 | ACO1 | aconitase 1 | |
|
2 | 2 | ||||||
| MIRT640894 | AMD1 | adenosylmethionine decarboxylase 1 | |
|
2 | 2 | ||||||
| MIRT641402 | SCN2B | sodium voltage-gated channel beta subunit 2 | |
|
2 | 2 | ||||||
| MIRT642083 | FBXL2 | F-box and leucine rich repeat protein 2 | |
|
2 | 2 | ||||||
| MIRT643179 | HYPK | huntingtin interacting protein K | |
|
2 | 2 | ||||||
| MIRT644205 | CBS | cystathionine-beta-synthase | |
|
2 | 2 | ||||||
| MIRT645453 | ANKS6 | ankyrin repeat and sterile alpha motif domain containing 6 | |
|
2 | 2 | ||||||
| MIRT645797 | OMA1 | OMA1 zinc metallopeptidase | |
|
2 | 2 | ||||||
| MIRT645960 | TTF2 | transcription termination factor 2 | |
|
2 | 2 | ||||||
| MIRT646334 | CLIC6 | chloride intracellular channel 6 | |
|
2 | 2 | ||||||
| MIRT646484 | APBB3 | amyloid beta precursor protein binding family B member 3 | |
|
2 | 2 | ||||||
| MIRT646611 | SMOC2 | SPARC related modular calcium binding 2 | |
|
2 | 2 | ||||||
| MIRT649392 | SH2D4A | SH2 domain containing 4A | |
|
2 | 2 | ||||||
| MIRT650540 | MSANTD2 | Myb/SANT DNA binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT650679 | CD82 | CD82 molecule | |
|
2 | 2 | ||||||
| MIRT652118 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | |
|
2 | 2 | ||||||
| MIRT652588 | TIMM8A | translocase of inner mitochondrial membrane 8A | |
|
2 | 2 | ||||||
| MIRT654807 | PPT1 | palmitoyl-protein thioesterase 1 | |
|
2 | 2 | ||||||
| MIRT655318 | PCYOX1 | prenylcysteine oxidase 1 | |
|
2 | 2 | ||||||
| MIRT655411 | PAN2 | PAN2 poly(A) specific ribonuclease subunit | |
|
2 | 2 | ||||||
| MIRT659671 | CD86 | CD86 molecule | |
|
2 | 2 | ||||||
| MIRT660190 | BMPR1A | bone morphogenetic protein receptor type 1A | |
|
2 | 2 | ||||||
| MIRT660883 | ADCYAP1R1 | ADCYAP receptor type I | |
|
2 | 2 | ||||||
| MIRT661695 | MTO1 | mitochondrial tRNA translation optimization 1 | |
|
2 | 2 | ||||||
| MIRT661765 | BIVM | basic, immunoglobulin-like variable motif containing | |
|
2 | 2 | ||||||
| MIRT662787 | TBC1D25 | TBC1 domain family member 25 | |
|
2 | 2 | ||||||
| MIRT663733 | ZNF285 | zinc finger protein 285 | |
|
2 | 2 | ||||||
| MIRT663787 | DDX53 | DEAD-box helicase 53 | |
|
2 | 2 | ||||||
| MIRT664663 | IMPA2 | inositol monophosphatase 2 | |
|
2 | 2 | ||||||
| MIRT665702 | TMX4 | thioredoxin related transmembrane protein 4 | |
|
2 | 2 | ||||||
| MIRT667444 | MAPK14 | mitogen-activated protein kinase 14 | |
|
2 | 2 | ||||||
| MIRT667946 | HMGCS1 | 3-hydroxy-3-methylglutaryl-CoA synthase 1 | |
|
2 | 2 | ||||||
| MIRT668776 | DAAM1 | dishevelled associated activator of morphogenesis 1 | |
|
2 | 4 | ||||||
| MIRT669824 | ISCA2 | iron-sulfur cluster assembly 2 | |
|
2 | 2 | ||||||
| MIRT670398 | ZXDA | zinc finger, X-linked, duplicated A | |
|
2 | 3 | ||||||
| MIRT670402 | ELP2 | elongator acetyltransferase complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT671112 | ZNF573 | zinc finger protein 573 | |
|
2 | 2 | ||||||
| MIRT671129 | CD226 | CD226 molecule | |
|
2 | 2 | ||||||
| MIRT671145 | ANKRD9 | ankyrin repeat domain 9 | |
|
2 | 2 | ||||||
| MIRT671315 | ACTR1A | ARP1 actin related protein 1 homolog A | |
|
2 | 2 | ||||||
| MIRT671329 | FAM71F2 | family with sequence similarity 71 member F2 | |
|
2 | 2 | ||||||
| MIRT671857 | ZNF429 | zinc finger protein 429 | |
|
2 | 2 | ||||||
| MIRT672009 | PXMP4 | peroxisomal membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT672054 | KIAA0930 | KIAA0930 | |
|
2 | 2 | ||||||
| MIRT672466 | RTTN | rotatin | |
|
2 | 2 | ||||||
| MIRT672642 | SLC25A16 | solute carrier family 25 member 16 | |
|
2 | 4 | ||||||
| MIRT672660 | GTF2H5 | general transcription factor IIH subunit 5 | |
|
2 | 2 | ||||||
| MIRT672755 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | |
|
2 | 2 | ||||||
| MIRT672839 | ICOSLG | inducible T-cell costimulator ligand | |
|
2 | 2 | ||||||
| MIRT672917 | LRRC2 | leucine rich repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT672983 | KBTBD6 | kelch repeat and BTB domain containing 6 | |
|
2 | 2 | ||||||
| MIRT673051 | AGO3 | argonaute 3, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT673078 | AK1 | adenylate kinase 1 | |
|
2 | 2 | ||||||
| MIRT673143 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT673303 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | |
|
2 | 2 | ||||||
| MIRT673319 | THAP1 | THAP domain containing 1 | |
|
2 | 2 | ||||||
| MIRT673339 | SLC35F6 | solute carrier family 35 member F6 | |
|
2 | 2 | ||||||
| MIRT673554 | PLA2G16 | phospholipase A2 group XVI | |
|
2 | 2 | ||||||
| MIRT673656 | ZNF440 | zinc finger protein 440 | |
|
2 | 2 | ||||||
| MIRT673693 | SGK494 | uncharacterized serine/threonine-protein kinase SgK494 | |
|
2 | 2 | ||||||
| MIRT673720 | EMCN | endomucin | |
|
2 | 2 | ||||||
| MIRT673840 | CALCOCO2 | calcium binding and coiled-coil domain 2 | |
|
2 | 2 | ||||||
| MIRT673869 | KLF2 | Kruppel like factor 2 | |
|
2 | 2 | ||||||
| MIRT673888 | DCTN6 | dynactin subunit 6 | |
|
2 | 2 | ||||||
| MIRT674180 | PLEKHM3 | pleckstrin homology domain containing M3 | |
|
2 | 2 | ||||||
| MIRT674579 | SLC35B4 | solute carrier family 35 member B4 | |
|
2 | 2 | ||||||
| MIRT674604 | RBBP4 | RB binding protein 4, chromatin remodeling factor | |
|
2 | 2 | ||||||
| MIRT674737 | SLC16A1 | solute carrier family 16 member 1 | |
|
2 | 2 | ||||||
| MIRT674824 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | |
|
2 | 2 | ||||||
| MIRT674993 | STRN3 | striatin 3 | |
|
2 | 2 | ||||||
| MIRT675058 | FGD6 | FYVE, RhoGEF and PH domain containing 6 | |
|
2 | 2 | ||||||
| MIRT675072 | CCR6 | C-C motif chemokine receptor 6 | |
|
2 | 2 | ||||||
| MIRT675116 | FSD2 | fibronectin type III and SPRY domain containing 2 | |
|
2 | 2 | ||||||
| MIRT675158 | YARS2 | tyrosyl-tRNA synthetase 2 | |
|
2 | 2 | ||||||
| MIRT675254 | LPP | LIM domain containing preferred translocation partner in lipoma | |
|
2 | 2 | ||||||
| MIRT675434 | LEAP2 | liver enriched antimicrobial peptide 2 | |
|
2 | 2 | ||||||
| MIRT675687 | PIWIL1 | piwi like RNA-mediated gene silencing 1 | |
|
2 | 2 | ||||||
| MIRT675772 | YIPF4 | Yip1 domain family member 4 | |
|
2 | 2 | ||||||
| MIRT675883 | SNAP29 | synaptosome associated protein 29 | |
|
2 | 2 | ||||||
| MIRT677923 | SLC35E1 | solute carrier family 35 member E1 | |
|
2 | 2 | ||||||
| MIRT678991 | MBD1 | methyl-CpG binding domain protein 1 | |
|
2 | 2 | ||||||
| MIRT679010 | MTMR10 | myotubularin related protein 10 | |
|
2 | 2 | ||||||
| MIRT679024 | ZNF419 | zinc finger protein 419 | |
|
2 | 2 | ||||||
| MIRT679392 | IL10RB | interleukin 10 receptor subunit beta | |
|
2 | 2 | ||||||
| MIRT679407 | GMCL1 | germ cell-less, spermatogenesis associated 1 | |
|
2 | 2 | ||||||
| MIRT683745 | C3orf36 | chromosome 3 open reading frame 36 | |
|
2 | 2 | ||||||
| MIRT689266 | ZNF99 | zinc finger protein 99 | |
|
2 | 2 | ||||||
| MIRT690502 | MDM2 | MDM2 proto-oncogene | |
|
2 | 2 | ||||||
| MIRT700939 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT702073 | PCDHB11 | protocadherin beta 11 | |
|
2 | 2 | ||||||
| MIRT705020 | CALU | calumenin | |
|
2 | 2 | ||||||
| MIRT706196 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT706253 | MKLN1 | muskelin 1 | |
|
2 | 2 | ||||||
| MIRT706540 | GJD2 | gap junction protein delta 2 | |
|
2 | 2 | ||||||
| MIRT707358 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
|
2 | 2 | ||||||
| MIRT707407 | RRP7A | ribosomal RNA processing 7 homolog A | |
|
2 | 2 | ||||||
| MIRT710638 | GLUL | glutamate-ammonia ligase | |
|
2 | 2 | ||||||
| MIRT714213 | C10orf71 | chromosome 10 open reading frame 71 | |
|
2 | 2 | ||||||
| MIRT715646 | USP6NL | USP6 N-terminal like | |
|
2 | 2 | ||||||
| MIRT717751 | KCNRG | potassium channel regulator | |
|
2 | 2 | ||||||
| MIRT720793 | GCH1 | GTP cyclohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT722254 | POLQ | DNA polymerase theta | |
|
2 | 2 | ||||||
| MIRT723765 | MPLKIP | M-phase specific PLK1 interacting protein | |
|
2 | 2 | ||||||
| MIRT724965 | TNS1 | tensin 1 | |
|
2 | 2 | ||||||
| MIRT736568 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | |
|
|
3 | 0 | |||||