| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-500b |
| Genomic Coordinates | chrX: 50010672 - 50010750 |
| Description | Homo sapiens miR-500b stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||
|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-500b-3p | ||||||
| Sequence | 51| GCACCCAGGCAAGGAUUCUG |70 | ||||||
| Evidence | Experimental | ||||||
| Experiments | Illumina | ||||||
| SNPs in miRNA |
|
||||||
| Putative Targets | |||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | KCTD15 | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | potassium channel tetramerization domain containing 15 | ||||||||||||||||||||
| Transcript | NM_024076 | ||||||||||||||||||||
| Other Transcripts | NM_001129995 , NM_001129994 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on KCTD15 | |||||||||||||||||||||
| 3'UTR of KCTD15 (miRNA target sites are highlighted) |
>KCTD15|NM_024076|3'UTR 1 AAATGGCCCAGAGTATTTTCAACAAAGCGTGCTTCATTTGACACCCAGAGTCTGACTTTGGATTCGAACTAAACCCAGGC 81 AACAGGCGAGGCAGGACAGAGGCTGAGTGGAAAGGTGGTCTGGAGCCCCTTCCCTCTCCCTGCTGACCTGGGAGTCGCAG 161 GCACCCACCAGCTGCCAAGAGAATCCCTGGACCGGCTCTTCCTGGATGGGTCCAAGAATTGGACAGCTCAGATGGAGTGA 241 GGGCCTATTTTCCAACAGCTCTTCGCAGACCCAAGAGCTTGGCACATTTCCGGGTTAGGGTGGAATGGGCTTTGCAGGGA 321 AGAGGGCCCCCTGTGCACGCATTCCACAGCCTGTCGGTCAGAACTTGCTAGTTGCAGGAGACGGGTGTTACACGCAGTCA 401 TCAGACCTCACCCTCACAGAGGCACAAACCCACATAGTTGTGGACGCCTGCAGAGACTCAAATATTGAGAGGACTTCTCC 481 TTTTTCTCTCCCTCCAGAGCTCCCACGAGCTGATGCACCCCCAGGCTTCAAACCACCTGGAATGCACAGCTCAGGGAAGC 561 TGGTGGATGCCTAGAGGCTGAAGGACAGGGAACTCTCCATTATTGGGGCAGGACTCAGGGAGGACACTTGGGGCCATGTG 641 TCTGGAGAGAGGGCATAGGTTACACCCTACAGAATAAAGAAGGGACCCAAAGCCTCTTTTTGCCTCCCGGAATCAAGGCC 721 CTGAGGGCAGCAGGATGGTGGCCTGGGTGGGGTCGTCCAACTAGGTTTGCTAACCTGAGGGGTCACTGGGCCTGGCCACT 801 TCTGTCCCTCTGGTGGTGGAACCCAGCACGTGGTTCTGTAGGGACCTTTGTCAGTGAGCAAGACTGAGATCGTCACAGGA 881 GAAGGTGCCCTTGCTGGCTGCCCCAGCAGGCACCCACCTCCCTGCCAGGCCAAGCCAGGTGTCCTCTTGCAGCTTGGCCT 961 TGATGACCTCTGTTTCTTCCTGGGCAGGTCCTGGAGCGGCTGTTCCAGAGGGGTTTCAGCGTGGCTGCGTCCTGTGGGGG 1041 CGGTGTGGACTCCTCCCAGTTCAGCGAGTATGTGCTTTGCCGGGAGGAGCGGCGGCCGCAGCCCACCCCCACTGCTGTTC 1121 GAATCAAGCAGGAACCCCTGGACTAGGCCCTGCTTCAGTGCCCACCTGGGCCCCCCCAGGGACCTGGAAACAGTGCTGGG 1201 GAGTTCTGCCTGTGTATACTTGGCCGTGGGCATGAGACCGAGGGTGAGGCTGGAGGGTCCAAAGCTGGCCCAGCGAGCAC 1281 CAGGGTCCCAGGTGTCATGGCAACAGAACGTGGGATGCTGGAGGCATGCCTGCAGAAGGACTGTTGATGCGACCCAAAGA 1361 TACAGCGGTGGGATCTCTGCTGCCAGCTCTCCCAGCCCCTCAGCTTCGCAGCCTGGCGCAGCATCCTCTGAGGCCCCGGG 1441 GCCTGTTGGGGCGGGGTTGGAAGAGCCGTCTGCAGCTACTTCAGAGGAGCTGTTTATCCCTCTCCACGCGGGGCAGACTC 1521 TGGCGGGTCTCCTAGCGTCCGAGAGATGGCTTATTTTCTACAGTATTTAAAATGGATGCAGCCCTAACTGCAAAAGTCAG 1601 AGAGGCTGACAAGGACCAATGCTTCTTTATCTGGTGCTCAGTTCTCAGTCAGACGTGCAGCATGGCTGCAGGGTGGACCA 1681 GCTGCCTGGCATTCAGGCCCAGATGCCTGCAGGGCTGGGGCTCTCGGGACAGATGCAGGGATGTGTGCTGCAGGGCTGCT 1761 GGGAGGAGAGTGGTGGGGGCCTGAGGGCTGAGTGATTCTGTAACCACCTGAGACCTTCACGTTTGCTGCCGTTGGGGGCT 1841 CAGGCTGCACTCCCCGGGTCACCTGACCTGCTGCCCAGGGGCTTCCAGTCCTGTCTGTGTGGACTGGCACCTGGGCTGCT 1921 GGAGAAGTCTCCTCCCGTTCGGACCAGCCTCAGGGCTGCACGTTACCTCAGGAATGGGCCCCACCATGAAGGGGCCCATC 2001 TGTCAGCAGCGTCTTCTAGGTCCCCAGCTCAGGGAGCCATCCCCAGCTCCAGTTTTCTCATGCGAATATGCACAGTTTTA 2081 ATTCACGTTGTTACACTAGCCTGCCGATGAGACCCAGACACAGGCAGACCTGGCGCTCTTGACCCCTGATTCCAGTGAGG 2161 ACTGGCCCTGAGGAGTCCTTGCAGACCTGCTGCCTCCCCCACGACAGGCCCAAAGATGGACCCCCCCTGGCCTTGTGACA 2241 GCTCCCCAAGTGTTCTCCGGTGGAGAAACTGCAGAGGACTGGTGGGCGGGGCTCCCCAGCCATCACCATCCTGTGTACAA 2321 TGGCTGTAGACTTGTATATGGCTCCTTTAATATTGTAAAGATGCTGATGTACAATTGTCGTGCATTTGTGTGAACACATT 2401 GCGTTCCCAGTCCATGCCATAAATGATGCTCTCAAGCAAAAGACTGGAGGCTCTGTCCTGTGCAGAAGCAGCAGCCAGAC 2481 TCCCGCATTCGATGTTGTGCAGGGAGGTTTGGGGGCGGAACGGATTCCTCCCTTGGATCCTTCAGTTCCCATCGAGGAAT 2561 AACCCGCAGCAGTGGTGGAGGAAGGTCAGTGGCTGGGTCCTGAGCTTGGTGTTATTTATTGCATTTGGGTGCCTGTCCCC 2641 TCAGGGCAGCACAGATTCTGAATTCTGATTCACAGTCCCTAGCCAGATGGGAACTGGGAAAGAGACAGAAGGCGTCTGGG 2721 TGCTTTTGAACCCTGTCTCAAATGTTTGGGATTTTCTCTCTCACTATTCTTTGGTTGGGGATGATGTCCTCTTTAGACCC 2801 CCACGTAATGGTATGAGAAGGTGGCAGGCAGTGGCTCAGCCAGCCAGGGGGCACCAAGTCATGCAGCCAGCGTGAGACCT 2881 GCAGTTCACCTAAGCACAGAACGAGATCTCAGTATGCCTCCATGTAAACAGATTCACATAGGCCTCCAATTTCAATGAGA 2961 CCTTTTGCATTTTTTCTCAAAGCCCTTATGTTCTAACCCATGAGAACCATTTTACCTGCCCTCTAAGGGCCACCAGCTTC 3041 GACCTGCCTCAGGGGACAGCAGCACAGACCAGTGGCTCCCTGTCCAAGGCCGCAGAGCAGACGCCATCCCACTGTACAAT 3121 CGAATTTGCTGGACAAACTTGATAGGTTTCTCTGCTTAGCAACGAGCCTATAGTTAGTTGGCACATCTGCGTTTTGGCAT 3201 CTGAGGCTCCCATCTGAGTGGAGGAGAAAGTGTTGTGTTTATTAGCAGGAAGTCTTGTGAAAACAGCTCGCTGCTGTGTA 3281 TGTTTATGGATTTTTCTGATATAACAGCCAGCATGGTTACCGAGTGGTAGAGATTCTCGAACATTCTCAAACTCTCTTTT 3361 TGGGTAAATGATTGTGCTAAAAATAAAATTTATTAATAAAGAAGGGGAAAAAGGAGTAACTCTACCTGACTAAATGTTAC 3441 TCTAATTTATTTATTTCTTTACTAATTAAGTAAAACCAGGAAGTATGATTTTACATCAACCAGAGAATTTCTGAATTTAT 3521 AGGGAAACACTATGTCCCCATAATGATGCTATAATTCTAATATATCTAGTCCCCATAAACAGTAAGTACAAATTATCATT 3601 CCTTTAAAGCATTTTTACACTTCCTGGAATGAGTATATTATCAGCAATCTTTTGTCAAATGCCAGCCGTATAAATGTTAC 3681 TTCTGCTCTTTGTAAACCTCAAAACTCATTATTCTTGATTATAAGCAACTGGACAGAACCATGCCAAAGCTTCCCCGTTT 3761 CCCACCAAACCCCTGCCAGTGAGTGCAGAGAACTCGCAAAGCCACAGCAGGCGGTCTCAGCCACCGTCCCGCTCACAGGG 3841 GCCCAATGCCAGGTCACAACACTAAGAATATCTTTCAAAAAATGTGTCTTTTTTTTTTTTTTTTTTAAAGCTACTGCTTG 3921 ACTGTTCCTTAGAATAAATAAAGGATATTTTATAAATTAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 79047.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000284006.6 | 3UTR | GGCAGCAGGAUGGUGGCCUGGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000284006.6 | 3UTR | GGCAGCAGGAUGGUGGCCUGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000284006.6 | 3UTR | GGCAGCAGGAUGGUGGCCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT059905 | HDGF | heparin binding growth factor |  |
|
2 | 4 | ||||||
| MIRT235394 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
|
2 | 4 | ||||||
| MIRT442246 | PYGO1 | pygopus family PHD finger 1 | |
|
2 | 2 | ||||||
| MIRT443591 | ZNF439 | zinc finger protein 439 | |
|
2 | 4 | ||||||
| MIRT453280 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | |
|
2 | 2 | ||||||
| MIRT463540 | ZBTB7A | zinc finger and BTB domain containing 7A | |
|
2 | 2 | ||||||
| MIRT465589 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 2 | ||||||
| MIRT469462 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 2 | ||||||
| MIRT485449 | KCTD15 | potassium channel tetramerization domain containing 15 | |
|
2 | 4 | ||||||
| MIRT486682 | WDR81 | WD repeat domain 81 | |
|
2 | 2 | ||||||
| MIRT489078 | POLM | DNA polymerase mu | |
|
2 | 2 | ||||||
| MIRT493734 | GREM2 | gremlin 2, DAN family BMP antagonist | |
|
2 | 2 | ||||||
| MIRT494872 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 2 | ||||||
| MIRT496130 | RNF103-CHMP3 | RNF103-CHMP3 readthrough | |
|
2 | 2 | ||||||
| MIRT496489 | CHMP3 | charged multivesicular body protein 3 | |
|
2 | 2 | ||||||
| MIRT496924 | CLMN | calmin | |
|
2 | 2 | ||||||
| MIRT497297 | TMEM119 | transmembrane protein 119 | |
|
2 | 2 | ||||||
| MIRT499103 | AGRN | agrin | |
|
2 | 2 | ||||||
| MIRT508979 | CXorf38 | chromosome X open reading frame 38 | |
|
2 | 2 | ||||||
| MIRT509911 | NIPAL1 | NIPA like domain containing 1 | |
|
2 | 2 | ||||||
| MIRT512820 | ARRDC2 | arrestin domain containing 2 | |
|
2 | 4 | ||||||
| MIRT512827 | KBTBD6 | kelch repeat and BTB domain containing 6 | |
|
2 | 4 | ||||||
| MIRT515360 | MRPL52 | mitochondrial ribosomal protein L52 | |
|
2 | 2 | ||||||
| MIRT516610 | TRIM58 | tripartite motif containing 58 | |
|
2 | 2 | ||||||
| MIRT517053 | TLDC1 | TBC/LysM-associated domain containing 1 | |
|
2 | 2 | ||||||
| MIRT517637 | ZNF491 | zinc finger protein 491 | |
|
2 | 2 | ||||||
| MIRT518270 | LEAP2 | liver enriched antimicrobial peptide 2 | |
|
2 | 2 | ||||||
| MIRT518625 | STAR | steroidogenic acute regulatory protein | |
|
2 | 2 | ||||||
| MIRT518887 | N4BP2L2 | NEDD4 binding protein 2 like 2 | |
|
2 | 2 | ||||||
| MIRT519026 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
|
2 | 2 | ||||||
| MIRT520365 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | |
|
2 | 2 | ||||||
| MIRT521106 | SLC1A5 | solute carrier family 1 member 5 | |
|
2 | 2 | ||||||
| MIRT521943 | PHC3 | polyhomeotic homolog 3 | |
|
2 | 2 | ||||||
| MIRT522253 | NPEPPS | aminopeptidase puromycin sensitive | |
|
2 | 2 | ||||||
| MIRT522853 | KIAA1551 | KIAA1551 | |
|
2 | 2 | ||||||
| MIRT522868 | KIAA1549 | KIAA1549 | |
|
2 | 2 | ||||||
| MIRT524207 | DDX19B | DEAD-box helicase 19B | |
|
2 | 2 | ||||||
| MIRT526004 | ARHGAP27 | Rho GTPase activating protein 27 | |
|
2 | 2 | ||||||
| MIRT527769 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | |
|
2 | 2 | ||||||
| MIRT527827 | TMEM74B | transmembrane protein 74B | |
|
2 | 2 | ||||||
| MIRT527861 | SMOC1 | SPARC related modular calcium binding 1 | |
|
2 | 2 | ||||||
| MIRT528040 | WT1 | Wilms tumor 1 | |
|
2 | 2 | ||||||
| MIRT529802 | ZDHHC8 | zinc finger DHHC-type containing 8 | |
|
2 | 2 | ||||||
| MIRT531723 | TARS | threonyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT531996 | BARD1 | BRCA1 associated RING domain 1 | |
|
2 | 2 | ||||||
| MIRT533338 | UNC119B | unc-119 lipid binding chaperone B | |
|
2 | 2 | ||||||
| MIRT533621 | TNFRSF13C | TNF receptor superfamily member 13C | |
|
2 | 2 | ||||||
| MIRT533652 | TMOD2 | tropomodulin 2 | |
|
2 | 2 | ||||||
| MIRT534397 | SENP3 | SUMO1/sentrin/SMT3 specific peptidase 3 | |
|
2 | 2 | ||||||
| MIRT538686 | CCDC80 | coiled-coil domain containing 80 | |
|
2 | 2 | ||||||
| MIRT540444 | RBM43 | RNA binding motif protein 43 | |
|
2 | 2 | ||||||
| MIRT542586 | ZC3H12C | zinc finger CCCH-type containing 12C | |
|
2 | 8 | ||||||
| MIRT542796 | PLEKHA3 | pleckstrin homology domain containing A3 | |
|
2 | 4 | ||||||
| MIRT542991 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | |
|
2 | 2 | ||||||
| MIRT544424 | ZNF460 | zinc finger protein 460 | |
|
2 | 4 | ||||||
| MIRT545740 | ESF1 | ESF1 nucleolar pre-rRNA processing protein homolog | |
|
2 | 4 | ||||||
| MIRT552618 | ZBTB8A | zinc finger and BTB domain containing 8A | |
|
2 | 2 | ||||||
| MIRT554456 | SAMD8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT569663 | PRIM1 | DNA primase subunit 1 | |
|
2 | 2 | ||||||
| MIRT569924 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | |
|
2 | 2 | ||||||
| MIRT570140 | IL1RL2 | interleukin 1 receptor like 2 | |
|
2 | 2 | ||||||
| MIRT573558 | TMEM120B | transmembrane protein 120B | |
|
2 | 2 | ||||||
| MIRT574282 | OPRD1 | opioid receptor delta 1 | |
|
2 | 2 | ||||||
| MIRT575335 | Fbxo6 | F-box protein 6 | |
|
2 | 2 | ||||||
| MIRT607057 | IDS | iduronate 2-sulfatase | |
|
2 | 2 | ||||||
| MIRT607078 | POM121L7 | POM121 transmembrane nucleoporin like 7 pseudogene | |
|
2 | 2 | ||||||
| MIRT607500 | HEBP2 | heme binding protein 2 | |
|
2 | 2 | ||||||
| MIRT607530 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT607808 | RHBDL2 | rhomboid like 2 | |
|
2 | 2 | ||||||
| MIRT608079 | ZFP14 | ZFP14 zinc finger protein | |
|
2 | 2 | ||||||
| MIRT609119 | NUDT3 | nudix hydrolase 3 | |
|
2 | 2 | ||||||
| MIRT609745 | PTCH1 | patched 1 | |
|
2 | 2 | ||||||
| MIRT612904 | HIF1AN | hypoxia inducible factor 1 alpha subunit inhibitor | |
|
2 | 2 | ||||||
| MIRT618720 | PCSK2 | proprotein convertase subtilisin/kexin type 2 | |
|
2 | 2 | ||||||
| MIRT618778 | HLA-E | major histocompatibility complex, class I, E | |
|
2 | 2 | ||||||
| MIRT619015 | SLC2A6 | solute carrier family 2 member 6 | |
|
2 | 2 | ||||||
| MIRT623223 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | |
|
2 | 2 | ||||||
| MIRT623819 | GEMIN6 | gem nuclear organelle associated protein 6 | |
|
2 | 2 | ||||||
| MIRT625704 | OPTN | optineurin | |
|
2 | 2 | ||||||
| MIRT626437 | CHDH | choline dehydrogenase | |
|
2 | 2 | ||||||
| MIRT628087 | KAT7 | lysine acetyltransferase 7 | |
|
2 | 2 | ||||||
| MIRT628936 | APOB | apolipoprotein B | |
|
2 | 2 | ||||||
| MIRT633543 | PGBD5 | piggyBac transposable element derived 5 | |
|
2 | 2 | ||||||
| MIRT634348 | SGOL1 | shugoshin 1 | |
|
2 | 2 | ||||||
| MIRT634611 | KIAA1919 | major facilitator superfamily domain containing 4B | |
|
2 | 2 | ||||||
| MIRT635243 | QPRT | quinolinate phosphoribosyltransferase | |
|
2 | 2 | ||||||
| MIRT636681 | BTLA | B and T lymphocyte associated | |
|
2 | 2 | ||||||
| MIRT636923 | ZNF845 | zinc finger protein 845 | |
|
2 | 2 | ||||||
| MIRT637606 | ZNF554 | zinc finger protein 554 | |
|
2 | 2 | ||||||
| MIRT639242 | RANGAP1 | Ran GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT640835 | POLR3A | RNA polymerase III subunit A | |
|
2 | 2 | ||||||
| MIRT642098 | FBXL2 | F-box and leucine rich repeat protein 2 | |
|
2 | 2 | ||||||
| MIRT643087 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | |
1 | 1 | |||||||
| MIRT643934 | C17orf104 | meiosis specific with coiled-coil domain | |
|
2 | 2 | ||||||
| MIRT644353 | FXN | frataxin | |
|
2 | 2 | ||||||
| MIRT645628 | SF3A3 | splicing factor 3a subunit 3 | |
|
2 | 2 | ||||||
| MIRT645754 | FAM213A | family with sequence similarity 213 member A | |
|
2 | 2 | ||||||
| MIRT646329 | MVB12B | multivesicular body subunit 12B | |
|
2 | 2 | ||||||
| MIRT646817 | COX19 | COX19, cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT647019 | ADCY2 | adenylate cyclase 2 | |
|
2 | 2 | ||||||
| MIRT647621 | IGSF9B | immunoglobulin superfamily member 9B | |
|
2 | 2 | ||||||
| MIRT648517 | PIGG | phosphatidylinositol glycan anchor biosynthesis class G | |
|
2 | 2 | ||||||
| MIRT648871 | ABCA6 | ATP binding cassette subfamily A member 6 | |
|
2 | 2 | ||||||
| MIRT649620 | ITPKC | inositol-trisphosphate 3-kinase C | |
|
2 | 2 | ||||||
| MIRT650062 | CCDC134 | coiled-coil domain containing 134 | |
|
2 | 2 | ||||||
| MIRT650734 | TNFSF8 | TNF superfamily member 8 | |
|
2 | 2 | ||||||
| MIRT652389 | TMEM55A | phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 | |
|
2 | 2 | ||||||
| MIRT654352 | RBM27 | RNA binding motif protein 27 | |
|
2 | 2 | ||||||
| MIRT655796 | NOVA2 | NOVA alternative splicing regulator 2 | |
|
2 | 2 | ||||||
| MIRT657329 | HNRNPK | heterogeneous nuclear ribonucleoprotein K | |
|
2 | 2 | ||||||
| MIRT657734 | GOSR1 | golgi SNAP receptor complex member 1 | |
|
2 | 2 | ||||||
| MIRT660613 | ANO6 | anoctamin 6 | |
|
2 | 2 | ||||||
| MIRT661243 | ARL17B | ADP ribosylation factor like GTPase 17B | |
|
2 | 2 | ||||||
| MIRT662245 | PGBD4 | piggyBac transposable element derived 4 | |
|
2 | 2 | ||||||
| MIRT662921 | MED18 | mediator complex subunit 18 | |
|
2 | 2 | ||||||
| MIRT662963 | JPH2 | junctophilin 2 | |
|
2 | 2 | ||||||
| MIRT663347 | ZNF74 | zinc finger protein 74 | |
|
2 | 2 | ||||||
| MIRT663528 | MASTL | microtubule associated serine/threonine kinase like | |
|
2 | 2 | ||||||
| MIRT663547 | CCR6 | C-C motif chemokine receptor 6 | |
|
2 | 2 | ||||||
| MIRT663977 | ZNF786 | zinc finger protein 786 | |
|
2 | 2 | ||||||
| MIRT664084 | METTL2B | methyltransferase like 2B | |
|
2 | 2 | ||||||
| MIRT664358 | C16orf45 | chromosome 16 open reading frame 45 | |
|
2 | 2 | ||||||
| MIRT664421 | TIGD6 | tigger transposable element derived 6 | |
|
2 | 2 | ||||||
| MIRT664476 | ZYG11B | zyg-11 family member B, cell cycle regulator | |
|
2 | 2 | ||||||
| MIRT664979 | TDRD1 | tudor domain containing 1 | |
|
2 | 2 | ||||||
| MIRT665128 | PYCRL | pyrroline-5-carboxylate reductase 3 | |
|
2 | 2 | ||||||
| MIRT666259 | SLC31A1 | solute carrier family 31 member 1 | |
|
2 | 2 | ||||||
| MIRT666321 | SLC16A10 | solute carrier family 16 member 10 | |
|
2 | 2 | ||||||
| MIRT666881 | POLQ | DNA polymerase theta | |
|
2 | 2 | ||||||
| MIRT668469 | FADS6 | fatty acid desaturase 6 | |
|
2 | 2 | ||||||
| MIRT669554 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | |
|
2 | 2 | ||||||
| MIRT669835 | ISCA2 | iron-sulfur cluster assembly 2 | |
|
2 | 2 | ||||||
| MIRT670185 | CCDC142 | coiled-coil domain containing 142 | |
|
2 | 2 | ||||||
| MIRT672020 | PXMP4 | peroxisomal membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT672070 | KIAA0930 | KIAA0930 | |
|
2 | 2 | ||||||
| MIRT672475 | RTTN | rotatin | |
|
2 | 2 | ||||||
| MIRT672851 | ICOSLG | inducible T-cell costimulator ligand | |
|
2 | 2 | ||||||
| MIRT673090 | AK1 | adenylate kinase 1 | |
|
2 | 2 | ||||||
| MIRT673581 | KDELC2 | KDEL motif containing 2 | |
|
2 | 2 | ||||||
| MIRT674586 | SLC35B4 | solute carrier family 35 member B4 | |
|
2 | 2 | ||||||
| MIRT675001 | STRN3 | striatin 3 | |
|
2 | 2 | ||||||
| MIRT679018 | MTMR10 | myotubularin related protein 10 | |
|
2 | 2 | ||||||
| MIRT679680 | STAT3 | signal transducer and activator of transcription 3 | |
|
2 | 2 | ||||||
| MIRT682833 | FLG2 | filaggrin family member 2 | |
|
2 | 2 | ||||||
| MIRT682886 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT683442 | AP3B2 | adaptor related protein complex 3 beta 2 subunit | |
|
2 | 2 | ||||||
| MIRT687040 | RNF115 | ring finger protein 115 | |
|
2 | 2 | ||||||
| MIRT691957 | RHOH | ras homolog family member H | |
|
2 | 2 | ||||||
| MIRT694625 | ZFPM1 | zinc finger protein, FOG family member 1 | |
|
2 | 2 | ||||||
| MIRT695637 | SLC26A2 | solute carrier family 26 member 2 | |
|
2 | 2 | ||||||
| MIRT697640 | WRN | Werner syndrome RecQ like helicase | |
|
2 | 2 | ||||||
| MIRT702009 | MIDN | midnolin | |
|
2 | 2 | ||||||
| MIRT702034 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT704789 | CDK6 | cyclin dependent kinase 6 | |
|
2 | 2 | ||||||
| MIRT705728 | AMMECR1L | AMMECR1 like | |
|
2 | 2 | ||||||
| MIRT705879 | ADM | adrenomedullin | |
|
2 | 2 | ||||||
| MIRT706220 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT708418 | CERS4 | ceramide synthase 4 | |
|
2 | 2 | ||||||
| MIRT709114 | C3orf18 | chromosome 3 open reading frame 18 | |
|
2 | 2 | ||||||
| MIRT709595 | ITPA | inosine triphosphatase | |
|
2 | 2 | ||||||
| MIRT710945 | MRPL45 | mitochondrial ribosomal protein L45 | |
|
2 | 2 | ||||||
| MIRT712345 | NLN | neurolysin | |
|
2 | 2 | ||||||
| MIRT712530 | CYTH2 | cytohesin 2 | |
|
2 | 2 | ||||||
| MIRT714019 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT717287 | ARMC12 | armadillo repeat containing 12 | |
|
2 | 2 | ||||||
| MIRT717733 | FGF1 | fibroblast growth factor 1 | |
|
2 | 2 | ||||||
| MIRT718083 | CLIC5 | chloride intracellular channel 5 | |
|
2 | 2 | ||||||
| MIRT718562 | MUC20 | mucin 20, cell surface associated | |
|
2 | 2 | ||||||
| MIRT721639 | MYLK3 | myosin light chain kinase 3 | |
|
2 | 2 | ||||||
| MIRT722632 | C8A | complement C8 alpha chain | |
|
2 | 2 | ||||||
| MIRT723177 | CDCA4 | cell division cycle associated 4 | |
|
2 | 2 | ||||||
| MIRT725523 | FAM229B | family with sequence similarity 229 member B | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|