>CDC25B|NM_004358|3'UTR
   1 GGGGCCTGCGCCAGTCCTGCTACCTCCCTTGCCTTTCGAGGCCTGAAGCCAGCTGCCCTATGGGCCTGCCGGGCTGAGGG
  81 CCTGCTGGAGGCCTCAGGTGCTGTCCATGGGAAAGATGGTGTGGGTGTCCTGCCTGTCTGCCCCAGCCCAGATTCCCCTG
 161 TGTCATCCCATCATTTTCCATATCCTGGTGCCCCCCACCCCTGGAAGAGCCCAGTCTGTTGAGTTAGTTAAGTTGGGTTA
 241 ATACCAGCTTAAAGGCAGTATTTTGTGTCCTCCAGGAGCTTCTTGTTTCCTTGTTAGGGTTAACCCTTCATCTTCCTGTG
 321 TCCTGAAACGCTCCTTTGTGTGTGTGTCAGCTGAGGCTGGGGGAGAGCCGTGGTCCCTGAGGATGGGTCAGAGCTAAACT
 401 CCTTCCTGGCCTGAGAGTCAGCTCTCTGCCCTGTGTACTTCCCGGGCCAGGGCTGCCCCTAATCTCTGTAGGAACCGTGG
 481 TATGTCTGCCATGTTGCCCCTTTCTCTTTTCCCCTTTCCTGTCCCACCATACGAGCACCTCCAGCCTGAACAGAAGCTCT
 561 TACTCTTTCCTATTTCAGTGTTACCTGTGTGCTTGGTCTGTTTGACTTTACGCCCATCTCAGGACACTTCCGTAGACTGT
 641 TTAGGTTCCCCTGTCAAATATCAGTTACCCACTCGGTCCCAGTTTTGTTGCCCCAGAAAGGGATGTTATTATCCTTGGGG
 721 GCTCCCAGGGCAAGGGTTAAGGCCTGAATCATGAGCCTGCTGGAAGCCCAGCCCCTACTGCTGTGAACCCTGGGGCCTGA
 801 CTGCTCAGAACTTGCTGCTGTCTTGTTGCGGATGGATGGAAGGTTGGATGGATGGGTGGATGGCCGTGGATGGCCGTGGA
 881 TGCGCAGTGCCTTGCATACCCAAACCAGGTGGGAGCGTTTTGTTGAGCATGACAGCCTGCAGCAGGAATATATGTGTGCC
 961 TATTTGTGTGGACAAAAATATTTACACTTAGGGTTTGGAGCTATTCAAGAGGAAATGTCACAGAAGCAGCTAAACCAAGG
1041 ACTGAGCACCCTCTGGATTCTGAATCTCAAGATGGGGGCAGGGCTGTGCTTGAAGGCCCTGCTGAGTCATCTGTTAGGGC
1121 CTTGGTTCAATAAAGCACTGAGCAAGTTGAGAAACCAGCA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucuUUCAUGA----AGGGAGACCUc 5' ||| ||| ||||||||| Target 5' accAAGGACTGAGCACCCTCTGGAt 3'	1034 - 1058	160.00	-18.00
2	miRNA 3' ucUUUCAUGAAGGGAGACcuc 5' |:||| | |:||||| Target 5' tgAGAGT-CAGCTCTCTGccc 3'	412 - 431	118.00	-14.52
3	miRNA 3' ucuuUCAUGAAG---GGAGACCUc 5' :||:| | || ||||| Target 5' tcctGGTGCCCCCCACCCCTGGAa 3'	183 - 206	117.00	-12.80

Mutant ID	Mutant Position	Mutant Source
COSN26969965	6	COSMIC
COSN2509744	29	COSMIC
COSN31573562	39	COSMIC
COSN25780857	134	COSMIC
COSN22228259	201	COSMIC
COSN22227251	217	COSMIC
COSN31485688	558	COSMIC
COSN31961823	633	COSMIC
COSN26551870	654	COSMIC
COSN20116228	668	COSMIC
COSN21724606	747	COSMIC
COSN26969966	885	COSMIC
COSN30102397	906	COSMIC
COSN30109166	937	COSMIC
COSN28676863	1030	COSMIC
COSN24496117	1043	COSMIC
COSN28714384	1074	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1299136211	3	dbSNP
rs1455837185	5	dbSNP
rs765478687	5	dbSNP
rs1330440463	7	dbSNP
rs371951429	10	dbSNP
rs751586446	10	dbSNP
rs758882919	11	dbSNP
rs1423877658	16	dbSNP
rs1383272901	17	dbSNP
rs372117595	20	dbSNP
rs751184849	23	dbSNP
rs756765620	24	dbSNP
rs780994372	29	dbSNP
rs745473093	32	dbSNP
rs755956022	34	dbSNP
rs1236392578	38	dbSNP
rs375603041	39	dbSNP
rs1188236004	41	dbSNP
rs1019211041	42	dbSNP
rs749078440	44	dbSNP
rs768540948	45	dbSNP
rs1001427511	46	dbSNP
rs774257429	46	dbSNP
rs747106927	50	dbSNP
rs770933742	51	dbSNP
rs776869786	53	dbSNP
rs558204135	58	dbSNP
rs957337181	61	dbSNP
rs1335548569	62	dbSNP
rs41279402	65	dbSNP
rs2229592	66	dbSNP
rs1028738332	72	dbSNP
rs1384253948	77	dbSNP
rs758565216	98	dbSNP
rs923429929	125	dbSNP
rs1411015858	126	dbSNP
rs1170285951	127	dbSNP
rs201707296	128	dbSNP
rs757847047	144	dbSNP
rs1396058672	146	dbSNP
rs1162123106	147	dbSNP
rs1050675523	155	dbSNP
rs1450578759	158	dbSNP
rs1195130201	160	dbSNP
rs909490229	166	dbSNP
rs555346175	167	dbSNP
rs1413226918	169	dbSNP
rs1038035218	179	dbSNP
rs781064452	180	dbSNP
rs1469728472	181	dbSNP
rs896907566	185	dbSNP
rs1318616699	188	dbSNP
rs745972023	189	dbSNP
rs1270737760	191	dbSNP
rs1334503900	191	dbSNP
rs756354563	194	dbSNP
rs984544288	197	dbSNP
rs1045899901	199	dbSNP
rs1306131208	203	dbSNP
rs11570020	212	dbSNP
rs1001795050	219	dbSNP
rs1034251298	222	dbSNP
rs368742502	223	dbSNP
rs1247988427	225	dbSNP
rs544315793	229	dbSNP
rs139271260	234	dbSNP
rs1169285244	237	dbSNP
rs55732615	242	dbSNP
rs1372315028	259	dbSNP
rs1020255729	270	dbSNP
rs189019990	271	dbSNP
rs564263612	286	dbSNP
rs937157812	287	dbSNP
rs1251039333	292	dbSNP
rs528382289	294	dbSNP
rs1191891915	298	dbSNP
rs1417950041	299	dbSNP
rs546868510	307	dbSNP
rs1174638564	320	dbSNP
rs895232688	327	dbSNP
rs561674811	330	dbSNP
rs528857480	331	dbSNP
rs976163728	334	dbSNP
rs1433251856	337	dbSNP
rs1300208091	339	dbSNP
rs1335841083	341	dbSNP
rs550715170	343	dbSNP
rs953552942	346	dbSNP
rs1395284092	347	dbSNP
rs6052085	351	dbSNP
rs568909554	361	dbSNP
rs1268532247	366	dbSNP
rs1393268854	368	dbSNP
rs1172942138	370	dbSNP
rs11087604	371	dbSNP
rs11087605	377	dbSNP
rs746917919	381	dbSNP
rs566907348	391	dbSNP
rs1345391996	399	dbSNP
rs1218542030	400	dbSNP
rs902124017	401	dbSNP
rs1286232215	402	dbSNP
rs996744511	414	dbSNP
rs1029124722	429	dbSNP
rs918219265	432	dbSNP
rs1210821856	433	dbSNP
rs952200621	434	dbSNP
rs1351982666	436	dbSNP
rs770908224	444	dbSNP
rs142635163	445	dbSNP
rs1334866665	452	dbSNP
rs906971182	469	dbSNP
rs1014703507	477	dbSNP
rs961998049	478	dbSNP
rs1311994879	481	dbSNP
rs1479285972	483	dbSNP
rs35980638	486	dbSNP
rs981160309	489	dbSNP
rs928535791	492	dbSNP
rs937314731	493	dbSNP
rs892974832	497	dbSNP
rs11570021	499	dbSNP
rs914376802	506	dbSNP
rs781369679	511	dbSNP
rs1255881149	512	dbSNP
rs1187248849	521	dbSNP
rs1448130251	528	dbSNP
rs555606861	531	dbSNP
rs1202922116	533	dbSNP
rs573720434	534	dbSNP
rs1349337799	543	dbSNP
rs537827811	573	dbSNP
rs549822140	578	dbSNP
rs1234773927	580	dbSNP
rs1400395211	582	dbSNP
rs935318533	585	dbSNP
rs759112847	599	dbSNP
rs764834161	601	dbSNP
rs1316133307	605	dbSNP
rs901841432	609	dbSNP
rs1388023684	612	dbSNP
rs1165692406	613	dbSNP
rs1463251261	615	dbSNP
rs1415929856	616	dbSNP
rs996411367	624	dbSNP
rs556273148	626	dbSNP
rs1475945512	631	dbSNP
rs953622808	632	dbSNP
rs1441745664	633	dbSNP
rs775097235	634	dbSNP
rs749119881	635	dbSNP
rs1302519133	636	dbSNP
rs181412320	640	dbSNP
rs1253118235	644	dbSNP
rs1050679883	645	dbSNP
rs887923974	653	dbSNP
rs986261320	660	dbSNP
rs1368733142	662	dbSNP
rs11570022	666	dbSNP
rs71331068	666	dbSNP
rs1016348125	670	dbSNP
rs963522242	673	dbSNP
rs1006419549	675	dbSNP
rs11570023	676	dbSNP
rs1349480831	678	dbSNP
rs1326725747	679	dbSNP
rs1443185201	682	dbSNP
rs1392646735	688	dbSNP
rs1203077290	694	dbSNP
rs1410689300	695	dbSNP
rs1422124796	699	dbSNP
rs929640860	701	dbSNP
rs1449441928	706	dbSNP
rs961855127	722	dbSNP
rs1002950790	723	dbSNP
rs1195029246	727	dbSNP
rs1212544537	728	dbSNP
rs1252874430	730	dbSNP
rs367792437	738	dbSNP
rs1245562186	742	dbSNP
rs1467555926	746	dbSNP
rs1204800987	756	dbSNP
rs928400136	757	dbSNP
rs1270668480	772	dbSNP
rs1227372050	775	dbSNP
rs1348579168	778	dbSNP
rs937046326	781	dbSNP
rs1035323890	786	dbSNP
rs958627741	791	dbSNP
rs774401224	797	dbSNP
rs1443246262	807	dbSNP
rs1356466488	809	dbSNP
rs1327335844	815	dbSNP
rs1429504534	816	dbSNP
rs1376373799	817	dbSNP
rs1469816711	819	dbSNP
rs991341875	830	dbSNP
rs914513765	831	dbSNP
rs1416251701	833	dbSNP
rs947221165	833	dbSNP
rs1041638624	838	dbSNP
rs903126396	841	dbSNP
rs1204264027	845	dbSNP
rs968510223	846	dbSNP
rs1282125199	850	dbSNP
rs760704535	856	dbSNP
rs769615558	856	dbSNP
rs1325347261	860	dbSNP
rs977257671	862	dbSNP
rs1392166348	866	dbSNP
rs924016813	867	dbSNP
rs935389502	871	dbSNP
rs1040865540	876	dbSNP
rs923269447	877	dbSNP
rs762648237	882	dbSNP
rs1433442352	883	dbSNP
rs1285539644	884	dbSNP
rs186687615	885	dbSNP
rs888061192	916	dbSNP
rs1232117250	917	dbSNP
rs1405084579	918	dbSNP
rs1270780078	923	dbSNP
rs1006386421	945	dbSNP
rs1475303285	954	dbSNP
rs1803263	960	dbSNP
rs897991618	968	dbSNP
rs1016316618	970	dbSNP
rs1002594297	976	dbSNP
rs1035864319	988	dbSNP
rs1251876434	989	dbSNP
rs1318827406	992	dbSNP
rs1228045571	1003	dbSNP
rs866968987	1004	dbSNP
rs963492713	1010	dbSNP
rs1394637405	1011	dbSNP
rs1379168403	1013	dbSNP
rs958380016	1018	dbSNP
rs993652242	1022	dbSNP
rs8156	1030	dbSNP
rs1180138749	1036	dbSNP
rs754744318	1046	dbSNP
rs968643992	1050	dbSNP
rs1475682882	1052	dbSNP
rs977309545	1054	dbSNP
rs778861081	1057	dbSNP
rs561933073	1059	dbSNP
rs1164281891	1063	dbSNP
rs1423031769	1065	dbSNP
rs1262095074	1070	dbSNP
rs924433572	1072	dbSNP
rs3516	1074	dbSNP
rs550588792	1078	dbSNP
rs1484827545	1083	dbSNP
rs1246302416	1087	dbSNP
rs976170302	1089	dbSNP
rs1208159535	1090	dbSNP
rs1335797690	1100	dbSNP
rs923377076	1102	dbSNP
rs1168364520	1103	dbSNP
rs991211849	1110	dbSNP
rs914348484	1114	dbSNP
rs1395710444	1126	dbSNP
rs947189908	1136	dbSNP
rs562494237	1140	dbSNP
rs567736829	1141	dbSNP
rs1319361592	1142	dbSNP
rs1041606163	1153	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.