pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3192 |
Genomic Coordinates | chr20: 18470615 - 18470691 |
Description | Homo sapiens miR-3192 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3192-5p | |||||||||||||||||||||||||||
Sequence | 10| UCUGGGAGGUUGUAGCAGUGGAA |32 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SLC7A5 | ||||||||||||||||||||
Synonyms | 4F2LC, CD98, D16S469E, E16, LAT1, MPE16 | ||||||||||||||||||||
Description | solute carrier family 7 member 5 | ||||||||||||||||||||
Transcript | NM_003486 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SLC7A5 | |||||||||||||||||||||
3'UTR of SLC7A5 (miRNA target sites are highlighted) |
>SLC7A5|NM_003486|3'UTR 1 CCAGGAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTCGAACCCACTCCGGTTC 81 CCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTCCCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAAC 161 TCTGGTACGAATCTCATCCCTCAACTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTC 241 TCCTTGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAATTTTGGGTCAACTTGA 321 CACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGCCTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGG 401 CAAACAGAGCTACTGAGACTTGGAACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGG 481 CTTGTGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGGAAACTCAGCCGTAGGG 561 TGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTCCTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTG 641 ACCATAATCCTAGCCCCGAGACACCATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCT 721 CACCAGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTGAGTTCTGGTTCATGCA 801 GACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAAGGCAGACACACCGCGGCCAGGCACCCATGTGGGCGC 881 CCACCCTGGGCTCCACACAGCAGTGTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTA 961 CCGCCCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTCTCCCTGTCACGCTCAT 1041 GTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCAAGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGG 1121 CCCCTGGGCTCTCACCCAGTCCCCACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATT 1201 TTTTTCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGCCTCCATGGCAGCAGCC 1281 AGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGCTCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCC 1361 TTCTCCCCAGCCAGAGGTGGAGCCAAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGC 1441 ACAGCCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCTGCTCAAGCCGCAAGCT 1521 CTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACCGGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACC 1601 TGATGAACAGTTTGGGGACTCAGGACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCC 1681 GTTGCTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTGGGGACGAATTCCACTC 1761 GTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCAGGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTC 1841 CCTCTGGGCCTGTTCTCTTGGCTGCAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCA 1921 GGAGGCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCACGCACCACTGCTTCCCA 2001 CTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTCCCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGT 2081 TCCAACCTCCTGCTCTGGGACGTGGACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTG 2161 TTGGCTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTAGTGAAATGGCTGGGGC 2241 CGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTCTGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGT 2321 GGGGGGTCCAGTCTGTGATCCTTGGTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGT 2401 CCCGCGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGACCAGGGCCACCGCAGG 2481 GGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCACACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTG 2561 TGGGCTTCAGGTGTTTTCAAGCACAACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCT 2641 AACGTCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCTTGCTGCTCTGCG 2721 TGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACGCAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTG 2801 GACACCCTCTGCCGAGTAATGACGTGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCT 2881 GGGTTGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATCCTACCGCTGAAAAAAA 2961 AAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000565644.1 | 3UTR | AGUCCCUCGCCGUCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000565644.1 | 3UTR | CCAGUCCCUCGCCGUCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
167 hsa-miR-3192-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT058548 | CTTNBP2NL | CTTNBP2 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT139892 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT207395 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 6 | ||||||
MIRT294640 | ZNF548 | zinc finger protein 548 | ![]() |
![]() |
2 | 2 | ||||||
MIRT324251 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441475 | BEST3 | bestrophin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445233 | SRGAP2 | SLIT-ROBO Rho GTPase activating protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446763 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451003 | EPS15L1 | epidermal growth factor receptor pathway substrate 15 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452436 | QDPR | quinoid dihydropteridine reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452582 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452950 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453309 | ZNF394 | zinc finger protein 394 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453810 | KBTBD12 | kelch repeat and BTB domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454101 | TMEM209 | transmembrane protein 209 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456228 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT456738 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456806 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT457499 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458037 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459041 | ZNF490 | zinc finger protein 490 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459135 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460126 | CXCL16 | C-X-C motif chemokine ligand 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460506 | FAM105A | family with sequence similarity 105 member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT460944 | NOA1 | nitric oxide associated 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461101 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT462641 | PHF5A | PHD finger protein 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT463584 | ZBTB38 | zinc finger and BTB domain containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466567 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467090 | SRRD | SRR1 domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT471093 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT472596 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473084 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475977 | GTPBP2 | GTP binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477054 | FAM210A | family with sequence similarity 210 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT478303 | DDX19A | DEAD-box helicase 19A | ![]() |
![]() |
2 | 4 | ||||||
MIRT478489 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478500 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478858 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479096 | CNNM4 | cyclin and CBS domain divalent metal cation transport mediator 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479180 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT479215 | CLCC1 | chloride channel CLIC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481176 | AVL9 | AVL9 cell migration associated | ![]() |
![]() |
2 | 6 | ||||||
MIRT483032 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT485150 | RASL10B | RAS like family 10 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT486104 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486319 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489443 | IFNLR1 | interferon lambda receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489585 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489702 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490184 | TMEM63C | transmembrane protein 63C | ![]() |
![]() |
2 | 2 | ||||||
MIRT491211 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491276 | DHX40 | DEAH-box helicase 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495162 | CNGA2 | cyclic nucleotide gated channel alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT495222 | DSCR3 | DSCR3 arrestin fold containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT496820 | CHRNB2 | cholinergic receptor nicotinic beta 2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT498602 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500003 | HIST1H2BD | histone cluster 1 H2B family member d | ![]() |
![]() |
2 | 4 | ||||||
MIRT502065 | KRAS | KRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT508197 | SLC35E1 | solute carrier family 35 member E1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508477 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509635 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 4 | ||||||
MIRT511039 | NRF1 | nuclear respiratory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516684 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518394 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518907 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT520502 | TRAM2 | translocation associated membrane protein 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT521459 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT522354 | NCKIPSD | NCK interacting protein with SH3 domain | ![]() |
![]() |
2 | 4 | ||||||
MIRT522594 | MAPK1IP1L | mitogen-activated protein kinase 1 interacting protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT523267 | HIST1H2AE | histone cluster 1 H2A family member e | ![]() |
![]() |
2 | 2 | ||||||
MIRT523532 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 4 | ||||||
MIRT524186 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT526842 | PHC1 | polyhomeotic homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528729 | FAM26E | calcium homeostasis modulator family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540695 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544483 | TRIM4 | tripartite motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551566 | LETM1 | leucine zipper and EF-hand containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563619 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564467 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565031 | VAV2 | vav guanine nucleotide exchange factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570294 | ARPC3 | actin related protein 2/3 complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572932 | VDAC2 | voltage dependent anion channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573501 | IQSEC3 | IQ motif and Sec7 domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573675 | HES6 | hes family bHLH transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609619 | TRPC4AP | transient receptor potential cation channel subfamily C member 4 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT611966 | PKD1 | polycystin 1, transient receptor potential channel interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT613930 | HIVEP3 | human immunodeficiency virus type I enhancer binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617733 | ATCAY | ATCAY, caytaxin | ![]() |
![]() |
2 | 4 | ||||||
MIRT618878 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627590 | SHROOM3 | shroom family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628516 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633964 | GRWD1 | glutamate rich WD repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634530 | NEGR1 | neuronal growth regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635455 | APOLD1 | apolipoprotein L domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636412 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT639672 | PPEF2 | protein phosphatase with EF-hand domain 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT642667 | RGS6 | regulator of G protein signaling 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644080 | A4GALT | alpha 1,4-galactosyltransferase (P blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT647318 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT647942 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648687 | AP1M1 | adaptor related protein complex 1 mu 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT648817 | ZNF689 | zinc finger protein 689 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650347 | TREM1 | triggering receptor expressed on myeloid cells 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650374 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT655935 | NDUFA4P1 | NDUFA4, mitochondrial complex associated pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663778 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664297 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665842 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668929 | COL9A2 | collagen type IX alpha 2 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT669673 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669907 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670248 | TRIM13 | tripartite motif containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670368 | ULBP3 | UL16 binding protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670642 | BVES | blood vessel epicardial substance | ![]() |
![]() |
2 | 2 | ||||||
MIRT670749 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671184 | ZNF891 | zinc finger protein 891 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673946 | ZNF500 | zinc finger protein 500 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674682 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677912 | HIST1H2BN | histone cluster 1 H2B family member n | ![]() |
![]() |
2 | 2 | ||||||
MIRT678876 | FAM118A | family with sequence similarity 118 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT679528 | RAB36 | RAB36, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT680589 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680650 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681149 | INTS7 | integrator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681177 | IBA57 | IBA57 homolog, iron-sulfur cluster assembly | ![]() |
![]() |
2 | 2 | ||||||
MIRT681234 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681626 | F2RL2 | coagulation factor II thrombin receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681643 | SCRG1 | stimulator of chondrogenesis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681926 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682050 | MRPS10 | mitochondrial ribosomal protein S10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682156 | SMS | spermine synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT683555 | HAVCR1 | hepatitis A virus cellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684304 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684458 | MFSD4 | major facilitator superfamily domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT685986 | CCDC77 | coiled-coil domain containing 77 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686782 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687329 | OSMR | oncostatin M receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT687629 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688792 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689756 | PRR13 | proline rich 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690823 | SGSM2 | small G protein signaling modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691310 | ZNF681 | zinc finger protein 681 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692676 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693508 | MOB3A | MOB kinase activator 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT694657 | C14orf119 | chromosome 14 open reading frame 119 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694889 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695740 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697101 | GPKOW | G-patch domain and KOW motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT698968 | SPAST | spastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT700379 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT703930 | EPG5 | ectopic P-granules autophagy protein 5 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT706234 | SYT15 | synaptotagmin 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706494 | SEPT6 | septin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710451 | BTNL3 | butyrophilin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711684 | ATF7IP | activating transcription factor 7 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT711997 | F9 | coagulation factor IX | ![]() |
![]() |
2 | 2 | ||||||
MIRT712727 | NCAPG2 | non-SMC condensin II complex subunit G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713111 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713156 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713440 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713830 | NUP98 | nucleoporin 98 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714979 | RAB21 | RAB21, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT717411 | ZCCHC24 | zinc finger CCHC-type containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718433 | ZNF85 | zinc finger protein 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720575 | SDHAF2 | succinate dehydrogenase complex assembly factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725098 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|