pre-miRNA Information
pre-miRNA hsa-mir-3192   
Genomic Coordinates chr20: 18470615 - 18470691
Description Homo sapiens miR-3192 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3192-5p
Sequence 10| UCUGGGAGGUUGUAGCAGUGGAA |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs906254403 3 dbSNP
rs554130490 4 dbSNP
rs773140898 6 dbSNP
rs376614009 11 dbSNP
rs899297329 12 dbSNP
rs1330418015 18 dbSNP
rs1402597660 21 dbSNP
rs995052311 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SIPA1   
Synonyms SPA1
Description signal-induced proliferation-associated 1
Transcript NM_006747   
Other Transcripts NM_153253   
Expression
Putative miRNA Targets on SIPA1
3'UTR of SIPA1
(miRNA target sites are highlighted)
>SIPA1|NM_006747|3'UTR
   1 GCCGTCTGGAACCACCTGGGCCCCTGAGGGCACTGTGGTCACACTGGGCCCTCCTCAGGAACTCTCCCTGCGCAGAGGCG
  81 TGTCTTAGCACTGCCCCCCTCCCTAGCCCCTTATTTGGTGGCGGAAGTGGCCTCCACCCCTTCCCTGTTTGTAAATATTC
 161 TGTGGAGAAAAGAGGACTTCAGGGAGTAAAAAAGCCACTGATGTCAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aagGUGACGAUGUUGGAGGG-UCu 5'
             ||||||  |  |||||| || 
Target 5' tagCACTGC--CCCCCTCCCTAGc 3'
86 - 107 132.00 -19.90
2
miRNA  3' aaGGUGACGAUGUUGGAGG-GUCu 5'
            :|||  ||: : ||||| ||| 
Target 5' ggTCAC-ACTGGGCCCTCCTCAGg 3'
37 - 59 124.00 -19.70
3
miRNA  3' aagguGACGAUGUUGGAGGGUCu 5'
               || | ||  |:|||| | 
Target 5' gtggcCT-CCACCCCTTCCCTGt 3'
127 - 148 105.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20041808 4 COSMIC
COSN30506387 5 COSMIC
COSN30666408 16 COSMIC
COSN28866014 72 COSMIC
COSN26440283 73 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779064577 3 dbSNP
rs748164933 4 dbSNP
rs374197908 5 dbSNP
rs778110310 6 dbSNP
rs745707237 8 dbSNP
rs1182186528 9 dbSNP
rs113349002 13 dbSNP
rs1189848233 16 dbSNP
rs1471404046 19 dbSNP
rs1158040425 22 dbSNP
rs774587201 24 dbSNP
rs982693005 24 dbSNP
rs1406133272 26 dbSNP
rs1470646968 27 dbSNP
rs1300591320 29 dbSNP
rs1402048315 31 dbSNP
rs1392480750 32 dbSNP
rs201626537 34 dbSNP
rs1243284504 41 dbSNP
rs1021091573 42 dbSNP
rs1309595907 43 dbSNP
rs762949652 45 dbSNP
rs1227991736 46 dbSNP
rs1284215767 49 dbSNP
rs576536003 50 dbSNP
rs1208054617 52 dbSNP
rs1255507653 53 dbSNP
rs1162207739 57 dbSNP
rs759493651 60 dbSNP
rs1235474159 64 dbSNP
rs549928466 72 dbSNP
rs976572800 73 dbSNP
rs778252399 80 dbSNP
rs569787128 81 dbSNP
rs1460562517 86 dbSNP
rs12420561 89 dbSNP
rs1166669938 94 dbSNP
rs1471463012 94 dbSNP
rs538927747 96 dbSNP
rs934573680 97 dbSNP
rs1374564754 98 dbSNP
rs145995596 100 dbSNP
rs565983838 102 dbSNP
rs1219533071 103 dbSNP
rs1468110509 108 dbSNP
rs114067690 116 dbSNP
rs1377692201 120 dbSNP
rs1228001190 123 dbSNP
rs1327448384 123 dbSNP
rs925938556 124 dbSNP
rs1287966185 125 dbSNP
rs1376214466 127 dbSNP
rs1272546896 130 dbSNP
rs934956350 132 dbSNP
rs1323944275 143 dbSNP
rs1394616743 144 dbSNP
rs1327417777 145 dbSNP
rs1455372830 152 dbSNP
rs1053294326 156 dbSNP
rs1159618240 165 dbSNP
rs773078343 174 dbSNP
rs1222772735 184 dbSNP
rs1420787595 187 dbSNP
rs1422918364 193 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' aaggugacgauguuggAGGGUCu 5'
                          |||| | 
Target 5' ----------------UCCCCGa 3'
1 - 7
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000534313.1 | 3UTR | UCCCCGACCCCGCCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
HNSC 0.986 0.05 1.000 0.5 3 Click to see details
167 hsa-miR-3192-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058548 CTTNBP2NL CTTNBP2 N-terminal like 2 2
MIRT139892 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT207395 MAT2A methionine adenosyltransferase 2A 2 6
MIRT294640 ZNF548 zinc finger protein 548 2 2
MIRT324251 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT441475 BEST3 bestrophin 3 2 2
MIRT445233 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT446763 ZNF491 zinc finger protein 491 2 2
MIRT451003 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 2
MIRT452436 QDPR quinoid dihydropteridine reductase 2 2
MIRT452582 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452950 DISC1 disrupted in schizophrenia 1 2 2
MIRT453309 ZNF394 zinc finger protein 394 2 2
MIRT453810 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT454101 TMEM209 transmembrane protein 209 2 2
MIRT456228 LIX1L limb and CNS expressed 1 like 2 4
MIRT456738 TMEM239 transmembrane protein 239 2 2
MIRT456806 SIGLEC14 sialic acid binding Ig like lectin 14 2 4
MIRT457499 SLC35F6 solute carrier family 35 member F6 2 2
MIRT458037 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT459041 ZNF490 zinc finger protein 490 2 2
MIRT459135 FADS6 fatty acid desaturase 6 2 2
MIRT460126 CXCL16 C-X-C motif chemokine ligand 16 2 2
MIRT460506 FAM105A family with sequence similarity 105 member A 2 6
MIRT460944 NOA1 nitric oxide associated 1 2 4
MIRT461101 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462641 PHF5A PHD finger protein 5A 2 2
MIRT463584 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT466567 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467090 SRRD SRR1 domain containing 2 2
MIRT471093 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472596 NACC1 nucleus accumbens associated 1 2 2
MIRT473084 MORN4 MORN repeat containing 4 2 2
MIRT475977 GTPBP2 GTP binding protein 2 2 2
MIRT477054 FAM210A family with sequence similarity 210 member A 2 2
MIRT478303 DDX19A DEAD-box helicase 19A 2 4
MIRT478489 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT478500 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT478858 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT479096 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT479180 CLSPN claspin 2 2
MIRT479215 CLCC1 chloride channel CLIC like 1 2 2
MIRT481176 AVL9 AVL9 cell migration associated 2 6
MIRT483032 KHSRP KH-type splicing regulatory protein 2 4
MIRT485150 RASL10B RAS like family 10 member B 2 2
MIRT486104 SLC7A5 solute carrier family 7 member 5 2 4
MIRT486319 SIPA1 signal-induced proliferation-associated 1 2 2
MIRT489443 IFNLR1 interferon lambda receptor 1 2 2
MIRT489585 SSBP2 single stranded DNA binding protein 2 2 2
MIRT489702 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT490184 TMEM63C transmembrane protein 63C 2 2
MIRT491211 MLLT1 MLLT1, super elongation complex subunit 2 4
MIRT491276 DHX40 DEAH-box helicase 40 2 2
MIRT495162 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495222 DSCR3 DSCR3 arrestin fold containing 2 2
MIRT496820 CHRNB2 cholinergic receptor nicotinic beta 2 subunit 2 2
MIRT498602 KRT8 keratin 8 2 2
MIRT500003 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT502065 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT508197 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508477 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT509635 RRP7A ribosomal RNA processing 7 homolog A 2 4
MIRT511039 NRF1 nuclear respiratory factor 1 2 2
MIRT516684 ZNF860 zinc finger protein 860 2 4
MIRT518394 ZNF250 zinc finger protein 250 2 2
MIRT518907 CDC14B cell division cycle 14B 2 2
MIRT520502 TRAM2 translocation associated membrane protein 2 2 6
MIRT521459 RAD51 RAD51 recombinase 2 2
MIRT522354 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT522594 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT523267 HIST1H2AE histone cluster 1 H2A family member e 2 2
MIRT523532 GLUL glutamate-ammonia ligase 2 4
MIRT524186 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT526842 PHC1 polyhomeotic homolog 1 2 2
MIRT528729 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT540695 BMP3 bone morphogenetic protein 3 2 2
MIRT544483 TRIM4 tripartite motif containing 4 2 2
MIRT551566 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT563619 ZNF277 zinc finger protein 277 2 2
MIRT564467 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565031 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT570294 ARPC3 actin related protein 2/3 complex subunit 3 2 2
MIRT572932 VDAC2 voltage dependent anion channel 2 2 2
MIRT573501 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT573675 HES6 hes family bHLH transcription factor 6 2 2
MIRT609619 TRPC4AP transient receptor potential cation channel subfamily C member 4 associated protein 2 2
MIRT611966 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613930 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT617733 ATCAY ATCAY, caytaxin 2 4
MIRT618878 MBL2 mannose binding lectin 2 2 2
MIRT627590 SHROOM3 shroom family member 3 2 2
MIRT628516 ZNF878 zinc finger protein 878 2 2
MIRT633964 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT634530 NEGR1 neuronal growth regulator 1 2 2
MIRT635455 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT636412 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT639672 PPEF2 protein phosphatase with EF-hand domain 2 2 6
MIRT642667 RGS6 regulator of G protein signaling 6 2 2
MIRT644080 A4GALT alpha 1,4-galactosyltransferase (P blood group) 2 2
MIRT647318 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT647942 RNF152 ring finger protein 152 2 2
MIRT648687 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT648817 ZNF689 zinc finger protein 689 2 2
MIRT650347 TREM1 triggering receptor expressed on myeloid cells 1 2 2
MIRT650374 MOCS3 molybdenum cofactor synthesis 3 2 4
MIRT655935 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT663778 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT664297 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT665842 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT668929 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT669673 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT669907 KIAA0754 KIAA0754 2 4
MIRT670248 TRIM13 tripartite motif containing 13 2 2
MIRT670368 ULBP3 UL16 binding protein 3 2 4
MIRT670642 BVES blood vessel epicardial substance 2 2
MIRT670749 HOOK3 hook microtubule tethering protein 3 2 2
MIRT671184 ZNF891 zinc finger protein 891 2 2
MIRT673946 ZNF500 zinc finger protein 500 2 2
MIRT674682 PLCE1 phospholipase C epsilon 1 2 2
MIRT677912 HIST1H2BN histone cluster 1 H2B family member n 2 2
MIRT678876 FAM118A family with sequence similarity 118 member A 2 2
MIRT679528 RAB36 RAB36, member RAS oncogene family 2 2
MIRT680589 ZNF573 zinc finger protein 573 2 2
MIRT680650 KIAA1456 KIAA1456 2 2
MIRT681149 INTS7 integrator complex subunit 7 2 2
MIRT681177 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT681234 DUSP19 dual specificity phosphatase 19 2 2
MIRT681626 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT681643 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT681926 KAT7 lysine acetyltransferase 7 2 2
MIRT682050 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT682156 SMS spermine synthase 2 2
MIRT683555 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684304 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT684458 MFSD4 major facilitator superfamily domain containing 4A 2 2
MIRT685986 CCDC77 coiled-coil domain containing 77 2 2
MIRT686782 AZF1 azoospermia factor 1 2 2
MIRT687329 OSMR oncostatin M receptor 2 2
MIRT687629 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT688792 CCNB1 cyclin B1 2 2
MIRT689756 PRR13 proline rich 13 2 2
MIRT690823 SGSM2 small G protein signaling modulator 2 2 2
MIRT691310 ZNF681 zinc finger protein 681 2 2
MIRT692676 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT693508 MOB3A MOB kinase activator 3A 2 2
MIRT694657 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694889 ZNF417 zinc finger protein 417 2 2
MIRT695740 ZNF117 zinc finger protein 117 2 2
MIRT697101 GPKOW G-patch domain and KOW motifs 2 2
MIRT698968 SPAST spastin 2 2
MIRT700379 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT703930 EPG5 ectopic P-granules autophagy protein 5 homolog 2 2
MIRT706234 SYT15 synaptotagmin 15 2 2
MIRT706494 SEPT6 septin 6 2 2
MIRT710451 BTNL3 butyrophilin like 3 2 2
MIRT711684 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT711997 F9 coagulation factor IX 2 2
MIRT712727 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713111 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT713156 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT713440 AJAP1 adherens junctions associated protein 1 2 2
MIRT713830 NUP98 nucleoporin 98 2 2
MIRT714979 RAB21 RAB21, member RAS oncogene family 2 2
MIRT717411 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT718433 ZNF85 zinc finger protein 85 2 2
MIRT720575 SDHAF2 succinate dehydrogenase complex assembly factor 2 2 2
MIRT725098 TMEM120B transmembrane protein 120B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3192 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3192 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3192 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3192-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-3192-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3192-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3192-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3192-5p Platinum 23939 resistant tissue
hsa-miR-3192-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3192-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3192-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission