pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3180-1 |
Genomic Coordinates | chr16: 14911220 - 14911313 |
Description | Homo sapiens miR-3180-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | hsa-mir-3180-2 |
Genomic Coordinates | chr16: 16309879 - 16309966 |
Description | Homo sapiens miR-3180-2 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | hsa-mir-3180-3 |
Genomic Coordinates | chr16: 18402178 - 18402271 |
Description | Homo sapiens miR-3180-3 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-3180-3p |
Sequence | 62| UGGGGCGGAGCUUCCGGAGGCC |83 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CLCN7 | ||||||||||||||||||||
Synonyms | CLC-7, CLC7, OPTA2, OPTB4, PPP1R63 | ||||||||||||||||||||
Description | chloride voltage-gated channel 7 | ||||||||||||||||||||
Transcript | NM_001114331 | ||||||||||||||||||||
Other Transcripts | NM_001287 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CLCN7 | |||||||||||||||||||||
3'UTR of CLCN7 (miRNA target sites are highlighted) |
>CLCN7|NM_001114331|3'UTR 1 GGCCCAGCCCTGCCCATAATGGGCACTGGCGCTGGCACCCCGGCCCTTCTGCATTTCCTCCCGGAGTCACTGGTTTCTCG 81 GCCCAAACCATGCTCCCCAGCAGTGGCAATGGCGAGCACCCTGCAGCTGGGCGGGCAGGCGGCAGGCGCGGAACTGACCC 161 TCTCGCGGGACTGACCCTGTTGTGGGCAGTGGTCTCCCCCCTTGGCGCCTCCTTGCGCAGGCCCAGCCTCCACTCTCCTC 241 GTCTAGGTTTCTTTACCTCCAGGGATCAGCTGTGTGTGTGTGACCTCCCTACCGGGCTATCGGCCTCTTGGGAGCCAGCG 321 GCAGGGCCGGCACCTGCGTGCCTGTGCCCGTGTGCGTGAGACAGAGCCCTTGCCCCTGCTGCTGCCCCGAGGGCTGCCCT 401 GCCCTGGAAGGGCCCCTCTGCCTCCACACCAGTGGAGTCTTCGAGACTTGGGAGCTGCTTGGCCTCATTTTCAGCCATGA 481 GCAGACGGCCTGTGGTCCCTGGGCCTGAGGCACGGACTCGTAGCACCAGGGTTTGGAGGCTGCGACCGCCCCGGAGAGCA 561 GCTTCACACTGGCGCCACAGAGGAGCCCCACGTGCACTCCCCGGCCTGCATCCGGCTTGGGTACACAGGCCCAGAGGACT 641 GGGGTGACTCACGGGCCCTGTGCTGTGATGTTGAGAGCTGAGAAAAACCTCCAAGGCCCTGAGCCCCATGCCCAGCCCTG 721 CCTTGGTCCCCCAACCCCCAGAGCTTGGAGTCTGGGCCCCACACCCAGCCCTGCCTTGGTCCCTGAGCCTCAGAGCGTGG 801 AATTGCTGCCCTGTGGACACTGGCTGGGAAGGCAGGTCTTCCCCTAGCACATGGGGACCCCGGCCTCGAGGGTGACCTCC 881 CTACCCCGCCCCTGCCAGCCACCAAGCGCAGGTGCAGCGGGGGCCAGACTCCTGCCGGCCTCAGAGGACACCTGGCCCAG 961 CACAGGCAGCTAGAAGGGCCGGTGGGCACCGGGGCCGGGAAGCCCCCACCTCACCACCTGAGGGCCCCTGGGAGGCTCCT 1041 CTGGCCTGGCTGGGCTGGGTCTGGGGCCGCCACAGGCCCCTCACGGGGCGGCAGAGGCAACTTCAGTGTCCCTGTTAGAG 1121 CAACACGGGTCCCTCCGTGGGGGGCTGGGTGCGGCCCCCTGCCGTGTATTTCCTCCCCAGGGAGTGGGGCCTCCCCGGGA 1201 GCTGACGCCACCACCCTGCTTAGCCCTCACAGGGCCCCAAGGTGTCCGAGTGTGTTGGGTCTGAACGCGAAATAAAGAAA 1281 TCCTCTCAGCCCGCCTTTGCCAGCGTCGTCCCTCCCACCCCACCCAGACCACGTCCAACAGCCTGGGACTTTCGGGACCC 1361 TGGGGTCGGGGCACCGTGTGGAGTGAGAAAGGCGTGAAAGACAGCGGCTGCGGCCACCCAGGGCACCAGCCACATCCTCT 1441 TCCTCGTCCCCGCCCCTCAGCCTCCCTCCTCTGGCTCCTGGCTGGTGGGTCTGGGGGCAAGGCAGAGGCGCTCCAGGTGG 1521 AGGGGGGCGGGCCGGGGTGCCCACGCTGGGGTGACGCAAGAAGAAAACTCCCGGGCCTCAGAGTCGGCGCCGGAAACCTA 1601 GGTCTGGGTTTCCCTCGTGGTGGTTGTGTACTGAGGACCTGGAAGTGATCATATTTTGGATATATTCGGTTAAATAAAAT 1681 CAGCGGTTAGGATTCACAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM4903829 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_a |
Location of target site | NM_001114331 | 3UTR | CUCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_001287 | 3UTR | UCCUCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903834 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_b |
Location of target site | NM_001114331 | 3UTR | CUCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_001114331 | 3UTR | UCCUCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_001114331 | 3UTR | UCCUCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_001114331 | 3UTR | UCUUCCUCGUCCCCG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000448525.1 | 3UTR | UCCUCGUCCCCGCCCCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
66 hsa-miR-3180-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT133792 | SKI | SKI proto-oncogene | 2 | 2 | ||||||||
MIRT146658 | MINK1 | misshapen like kinase 1 | 2 | 4 | ||||||||
MIRT441337 | C19orf26 | CACN beta subunit associated regulatory protein | 2 | 4 | ||||||||
MIRT449088 | XPO6 | exportin 6 | 2 | 2 | ||||||||
MIRT464967 | TULP1 | tubby like protein 1 | 2 | 6 | ||||||||
MIRT471706 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | 2 | 2 | ||||||||
MIRT473252 | MIDN | midnolin | 2 | 2 | ||||||||
MIRT483494 | STMN3 | stathmin 3 | 2 | 4 | ||||||||
MIRT483726 | THSD4 | thrombospondin type 1 domain containing 4 | 2 | 2 | ||||||||
MIRT485684 | CCDC64 | BICD family like cargo adaptor 1 | 2 | 4 | ||||||||
MIRT486046 | WSCD1 | WSC domain containing 1 | 2 | 4 | ||||||||
MIRT486522 | CLCN7 | chloride voltage-gated channel 7 | 2 | 2 | ||||||||
MIRT486779 | SESTD1 | SEC14 and spectrin domain containing 1 | 2 | 4 | ||||||||
MIRT486852 | DPF1 | double PHD fingers 1 | 2 | 2 | ||||||||
MIRT487035 | C10orf55 | chromosome 10 open reading frame 55 | 2 | 2 | ||||||||
MIRT487082 | C3orf36 | chromosome 3 open reading frame 36 | 2 | 2 | ||||||||
MIRT487284 | AGPAT6 | glycerol-3-phosphate acyltransferase 4 | 2 | 4 | ||||||||
MIRT487992 | RXRB | retinoid X receptor beta | 2 | 2 | ||||||||
MIRT488101 | POU3F1 | POU class 3 homeobox 1 | 2 | 2 | ||||||||
MIRT488547 | POU3F3 | POU class 3 homeobox 3 | 2 | 8 | ||||||||
MIRT488582 | ST7L | suppression of tumorigenicity 7 like | 2 | 2 | ||||||||
MIRT488757 | FXYD1 | FXYD domain containing ion transport regulator 1 | 2 | 2 | ||||||||
MIRT489217 | ASCL2 | achaete-scute family bHLH transcription factor 2 | 2 | 4 | ||||||||
MIRT489350 | SYNGR1 | synaptogyrin 1 | 2 | 4 | ||||||||
MIRT489385 | RAB11B | RAB11B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT489459 | MSC | musculin | 2 | 2 | ||||||||
MIRT489469 | SLITRK5 | SLIT and NTRK like family member 5 | 2 | 2 | ||||||||
MIRT489749 | TACC3 | transforming acidic coiled-coil containing protein 3 | 2 | 2 | ||||||||
MIRT490244 | MFI2 | melanotransferrin | 2 | 2 | ||||||||
MIRT490423 | VPS51 | VPS51, GARP complex subunit | 2 | 4 | ||||||||
MIRT490644 | FEM1A | fem-1 homolog A | 2 | 2 | ||||||||
MIRT491977 | UNK | unkempt family zinc finger | 2 | 2 | ||||||||
MIRT492469 | RASD1 | ras related dexamethasone induced 1 | 2 | 4 | ||||||||
MIRT492837 | NRGN | neurogranin | 2 | 2 | ||||||||
MIRT492956 | NEUROD2 | neuronal differentiation 2 | 2 | 2 | ||||||||
MIRT493002 | NANOS1 | nanos C2HC-type zinc finger 1 | 2 | 2 | ||||||||
MIRT493430 | KCNK3 | potassium two pore domain channel subfamily K member 3 | 2 | 2 | ||||||||
MIRT493709 | H2AFX | H2A histone family member X | 2 | 6 | ||||||||
MIRT493886 | FAM43A | family with sequence similarity 43 member A | 2 | 4 | ||||||||
MIRT493955 | ENG | endoglin | 2 | 2 | ||||||||
MIRT500168 | MSI1 | musashi RNA binding protein 1 | 2 | 2 | ||||||||
MIRT500196 | MAPK8IP3 | mitogen-activated protein kinase 8 interacting protein 3 | 2 | 4 | ||||||||
MIRT500366 | ZNF385A | zinc finger protein 385A | 2 | 2 | ||||||||
MIRT501159 | SLC10A7 | solute carrier family 10 member 7 | 2 | 6 | ||||||||
MIRT501698 | PCGF3 | polycomb group ring finger 3 | 2 | 6 | ||||||||
MIRT512173 | CASP16 | caspase 16, pseudogene | 2 | 6 | ||||||||
MIRT512237 | ATG2A | autophagy related 2A | 2 | 6 | ||||||||
MIRT512879 | PITX3 | paired like homeodomain 3 | 2 | 2 | ||||||||
MIRT531184 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | 2 | 2 | ||||||||
MIRT548362 | ENTPD5 | ectonucleoside triphosphate diphosphohydrolase 5 | 2 | 4 | ||||||||
MIRT569093 | FSCN1 | fascin actin-bundling protein 1 | 2 | 2 | ||||||||
MIRT574133 | MARVELD1 | MARVEL domain containing 1 | 2 | 2 | ||||||||
MIRT635542 | LEPROTL1 | leptin receptor overlapping transcript like 1 | 2 | 2 | ||||||||
MIRT654098 | RSBN1L | round spermatid basic protein 1 like | 2 | 2 | ||||||||
MIRT664919 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | 2 | 2 | ||||||||
MIRT669843 | OLR1 | oxidized low density lipoprotein receptor 1 | 2 | 2 | ||||||||
MIRT670502 | LYRM4 | LYR motif containing 4 | 2 | 2 | ||||||||
MIRT670526 | SLC9A7 | solute carrier family 9 member A7 | 2 | 2 | ||||||||
MIRT670550 | SHISA2 | shisa family member 2 | 2 | 2 | ||||||||
MIRT671031 | PCDHB2 | protocadherin beta 2 | 2 | 2 | ||||||||
MIRT695219 | SCAMP3 | secretory carrier membrane protein 3 | 2 | 2 | ||||||||
MIRT700129 | RNF144B | ring finger protein 144B | 2 | 2 | ||||||||
MIRT709280 | MAPK8IP2 | mitogen-activated protein kinase 8 interacting protein 2 | 2 | 2 | ||||||||
MIRT712750 | GMDS | GDP-mannose 4,6-dehydratase | 2 | 2 | ||||||||
MIRT720753 | FAM193A | family with sequence similarity 193 member A | 2 | 2 | ||||||||
MIRT724920 | VPS18 | VPS18, CORVET/HOPS core subunit | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|