miRTarBase - #MIRT486674


—
pre-miRNA Information
pre-miRNA hsa-mir-1268a   
Genomic Coordinates chr15: 22225278 - 22225329
Description Homo sapiens miR-1268a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1268a
Sequence 5| CGGGCGUGGUGGUGGGGG |22
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369807489 1 dbSNP
rs537950017 2 dbSNP
rs1442921203 4 dbSNP
rs1242314811 5 dbSNP
rs28599926 6 dbSNP
rs931410682 7 dbSNP
rs1360584039 10 dbSNP
rs1245652939 12 dbSNP
rs1321701831 14 dbSNP
rs1260292644 16 dbSNP
rs879525551 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WDR81   
Synonyms CAMRQ2, PPP1R166, SORF-2
Description WD repeat domain 81
Transcript NM_001163673   
Other Transcripts NM_001163809 , NM_001163811 , NM_152348   
Expression
Putative miRNA Targets on WDR81
3'UTR of WDR81
(miRNA target sites are highlighted)		 
>WDR81|NM_001163673|3'UTR
   1 ACTGAGGCAGGAGCTGGCCGGGCAAGGGTGGGAAGACATCTGCGGGCGCGTGTCCACTCACCCTGTTCCCTGAGCAGCAG
  81 CTCCCTCCAGGGAGGCCCTGGGTCCCACGCCCTGGGTGCCCACATGGCCTGCCAACTAGGGCCTGCAAATGGAGTGGGGG
 161 AGTCCTGGCCCCTGAATCACCAGAGCCACCAAGCCTGCCAGAGGGGTCTCATTCATGGCTTGGGGACACAGGGCTCCTAG
 241 CAAGCAGGAAGTTAAGAGCAGGAGGAAGCGTTGCTACCTTCACTTCTCCCCAGCTCTGCCCTCTGGGTCCACATGAGGAC
 321 AGGGAAGCTCGGGAAGGGGAAGGGAGACTGGCCCTGCCCAGCCGGTCTCTAGCCCCTCAGCCCCCGCTGGGCACTCTCTG
 401 TCCCATCCCTCTAGGACAGGGAAGCTGGCCTGGTCCAGGGCACTGATGGTGCTTGGATTCCAGCCTAAGGAAGGCTGGCC
 481 GTGGTCCAGGAGTTAAGGGCTTGGGTCTGGGGTTTAAGTGGCCACCCATCCAGGCCCTGGCCAGTGTGGGACCGGGACGG
 561 GAAGGAAGAAGGAGGCTAGGAGCAGGGGGAAAAGGTGCACTTGGCCAGTGGCGCCTGCCAGGAGTGAGTCCATGCGTTGT
 641 CTGCCCACCCCTACCACAGTGTTTGTGCCTTCAGCTGAGGGGGCAGCCTCTGGGCCCTGAACCCCTGCTGGGGCTCCACG
 721 ACCCTGAGAGAAGGGGTGAGAAGAATCATCTCTGCACCTCGGGTCTCTGCCAGAGGAAGACTTAAGCATCCCTGCGACCT
 801 CACATTCTAGACAGAGATGAGGTCCAGGGGTTGGCCCCTGCTGCCTTCTCACAATTTGCAATAGATGTAAATAGGACCAA
 881 TAAATCCTTTGGAAGAGCCATGGGGTGAACTGAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGGG---UGGUGGUGCGGGc 5'
            |||   ::| |||||||| 
Target 5' ggCCCTGGGTC-CCACGCCCt 3'
 94 - 113 147.00 -23.60
2 
miRNA  3' gggGGU-GGU-GGUGCGGGc 5'
             ||| ||| ||| |||| 
Target 5' tggCCACCCATCCAGGCCCt 3'
 519 - 538 127.00 -20.60
3 
miRNA  3' ggGGGUG-----GUGGUGCGGGc 5'
            ||::|     | ||||| || 
Target 5' ccCCTGCTGGGGCTCCACGACCc 3'
 702 - 724 116.00 -22.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1185335 57 ClinVar
COSN30506739 10 COSMIC
COSN17164317 45 COSMIC
COSN30539211 53 COSMIC
COSN30451030 56 COSMIC
COSN6653339 57 COSMIC
COSN31488457 175 COSMIC
COSN8832338 176 COSMIC
COSN31488364 204 COSMIC
COSN8393514 266 COSMIC
COSN24967912 355 COSMIC
COSN31609053 425 COSMIC
COSN31557527 470 COSMIC
COSN31597090 481 COSMIC
COSN31607922 558 COSMIC
COSN30174659 582 COSMIC
COSN28685916 586 COSMIC
COSN31487258 627 COSMIC
COSN16127642 678 COSMIC
COSN31529978 731 COSMIC
COSN16127532 741 COSMIC
COSN16127560 761 COSMIC
COSN16127650 815 COSMIC
COSN31488269 820 COSMIC
COSN6653343 828 COSMIC
COSN31523333 841 COSMIC
rs2287322 57 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758278135 3 dbSNP
rs896237078 8 dbSNP
rs779847715 12 dbSNP
rs746828815 15 dbSNP
rs1346526023 16 dbSNP
rs373156614 20 dbSNP
rs748224837 21 dbSNP
rs769845680 23 dbSNP
rs773179350 24 dbSNP
rs1286565415 26 dbSNP
rs560335168 30 dbSNP
rs750082551 30 dbSNP
rs1447756145 31 dbSNP
rs1356441142 33 dbSNP
rs1187132120 35 dbSNP
rs1236626430 36 dbSNP
rs1442552144 38 dbSNP
rs551272368 39 dbSNP
rs774669884 42 dbSNP
rs887458802 43 dbSNP
rs759946368 44 dbSNP
rs753558489 45 dbSNP
rs1169962518 46 dbSNP
rs764744022 47 dbSNP
rs144638864 48 dbSNP
rs375681186 49 dbSNP
rs374841920 50 dbSNP
rs186162259 51 dbSNP
rs1030617768 56 dbSNP
rs2287322 57 dbSNP
rs906762205 63 dbSNP
rs1233460592 64 dbSNP
rs1335923814 68 dbSNP
rs1249869178 69 dbSNP
rs1003823398 71 dbSNP
rs1449964991 89 dbSNP
rs534508606 102 dbSNP
rs557481891 103 dbSNP
rs1169516513 109 dbSNP
rs988900046 110 dbSNP
rs1033668749 117 dbSNP
rs1462226146 119 dbSNP
rs577423320 125 dbSNP
rs1162585224 141 dbSNP
rs994839647 149 dbSNP
rs1364340953 153 dbSNP
rs1467266058 157 dbSNP
rs1183835917 159 dbSNP
rs1416801918 162 dbSNP
rs752192166 165 dbSNP
rs980120579 171 dbSNP
rs147897034 179 dbSNP
rs938972960 193 dbSNP
rs1321933044 195 dbSNP
rs1368011048 198 dbSNP
rs573214180 204 dbSNP
rs755595711 205 dbSNP
rs1302080980 211 dbSNP
rs918760182 220 dbSNP
rs777154276 232 dbSNP
rs879486744 250 dbSNP
rs557243878 252 dbSNP
rs1241720097 257 dbSNP
rs1334504562 260 dbSNP
rs754331793 261 dbSNP
rs887551104 270 dbSNP
rs117022317 271 dbSNP
rs190097774 272 dbSNP
rs1038709473 274 dbSNP
rs1397006538 275 dbSNP
rs900414643 278 dbSNP
rs997844912 291 dbSNP
rs1404569383 292 dbSNP
rs3826539 298 dbSNP
rs956079073 299 dbSNP
rs1160233964 316 dbSNP
rs1010300419 326 dbSNP
rs746301099 331 dbSNP
rs974597339 332 dbSNP
rs1201891096 338 dbSNP
rs968816465 343 dbSNP
rs1192563151 351 dbSNP
rs921606205 352 dbSNP
rs1025121801 357 dbSNP
rs980097899 364 dbSNP
rs573328721 365 dbSNP
rs1285891355 372 dbSNP
rs182794413 379 dbSNP
rs1373222016 380 dbSNP
rs565445283 382 dbSNP
rs913008804 384 dbSNP
rs918740390 385 dbSNP
rs531157683 386 dbSNP
rs1042577555 387 dbSNP
rs1428213682 388 dbSNP
rs1359869486 391 dbSNP
rs550589667 393 dbSNP
rs1436071871 394 dbSNP
rs939588526 394 dbSNP
rs1171479060 396 dbSNP
rs1388651815 402 dbSNP
rs561663469 406 dbSNP
rs1243466762 408 dbSNP
rs1195831771 413 dbSNP
rs1055342405 416 dbSNP
rs908957516 421 dbSNP
rs1350146657 425 dbSNP
rs1454764105 426 dbSNP
rs1278374833 428 dbSNP
rs1288861735 436 dbSNP
rs941823033 438 dbSNP
rs1340385786 439 dbSNP
rs994870675 449 dbSNP
rs1428422887 455 dbSNP
rs534075635 456 dbSNP
rs548616433 461 dbSNP
rs1313425546 466 dbSNP
rs900174553 469 dbSNP
rs1416472734 478 dbSNP
rs370504275 481 dbSNP
rs112099834 482 dbSNP
rs1410008239 500 dbSNP
rs1421245327 505 dbSNP
rs891733099 507 dbSNP
rs768738601 510 dbSNP
rs1010058383 519 dbSNP
rs974545301 524 dbSNP
rs1028900770 525 dbSNP
rs1189085445 527 dbSNP
rs957271842 533 dbSNP
rs989855185 536 dbSNP
rs1209562703 538 dbSNP
rs912865435 554 dbSNP
rs534372781 555 dbSNP
rs551074128 559 dbSNP
rs1293740730 560 dbSNP
rs1215141581 573 dbSNP
rs928118237 575 dbSNP
rs1353528103 577 dbSNP
rs776591866 580 dbSNP
rs1442323937 584 dbSNP
rs1055289458 586 dbSNP
rs1326448231 588 dbSNP
rs1464837608 591 dbSNP
rs1034327929 595 dbSNP
rs1166167958 601 dbSNP
rs1476375318 610 dbSNP
rs960332742 613 dbSNP
rs762923110 614 dbSNP
rs1026303947 619 dbSNP
rs569006864 625 dbSNP
rs148963581 629 dbSNP
rs1457521781 630 dbSNP
rs1274007876 633 dbSNP
rs951666630 635 dbSNP
rs116026578 636 dbSNP
rs1319649694 636 dbSNP
rs796545171 637 dbSNP
rs1224201057 638 dbSNP
rs1375435671 642 dbSNP
rs1277321404 644 dbSNP
rs1445378477 648 dbSNP
rs1049073647 649 dbSNP
rs886405713 651 dbSNP
rs141905948 652 dbSNP
rs1348442740 658 dbSNP
rs1019486515 660 dbSNP
rs941749670 665 dbSNP
rs974911138 666 dbSNP
rs995994007 669 dbSNP
rs1459858432 673 dbSNP
rs1176894859 679 dbSNP
rs921588406 680 dbSNP
rs1028763661 691 dbSNP
rs879430249 698 dbSNP
rs1253891067 700 dbSNP
rs142610446 705 dbSNP
rs1365272840 706 dbSNP
rs990443345 709 dbSNP
rs1264707932 710 dbSNP
rs1403487123 712 dbSNP
rs1290508777 713 dbSNP
rs1283763317 715 dbSNP
rs77361038 720 dbSNP
rs891707885 721 dbSNP
rs1347915369 725 dbSNP
rs536643499 726 dbSNP
rs1438176739 728 dbSNP
rs375278261 729 dbSNP
rs904372943 731 dbSNP
rs1310 737 dbSNP
rs1223056271 745 dbSNP
rs1347494406 745 dbSNP
rs1157331138 748 dbSNP
rs533578042 753 dbSNP
rs1395692111 757 dbSNP
rs1175591793 758 dbSNP
rs116042891 761 dbSNP
rs1419045043 762 dbSNP
rs991005968 763 dbSNP
rs866709777 766 dbSNP
rs1486702624 768 dbSNP
rs750898000 769 dbSNP
rs1025684355 775 dbSNP
rs371543660 784 dbSNP
rs1347979577 785 dbSNP
rs753339794 787 dbSNP
rs1480087004 793 dbSNP
rs1174999855 795 dbSNP
rs951591796 796 dbSNP
rs565407963 797 dbSNP
rs1215545534 802 dbSNP
rs1342706541 807 dbSNP
rs1426083638 809 dbSNP
rs984345566 813 dbSNP
rs757753213 814 dbSNP
rs964196777 817 dbSNP
rs1045806 828 dbSNP
rs921663438 830 dbSNP
rs1464584518 831 dbSNP
rs1385146214 833 dbSNP
rs1377318356 834 dbSNP
rs1171341798 837 dbSNP
rs940721607 846 dbSNP
rs933116154 853 dbSNP
rs1423185896 855 dbSNP
rs1485992527 860 dbSNP
rs1259503980 862 dbSNP
rs559168746 867 dbSNP
rs1482615694 875 dbSNP
rs1355368767 877 dbSNP
rs1206098948 881 dbSNP
rs987505556 884 dbSNP
rs912911739 888 dbSNP
rs945920237 890 dbSNP
rs1043015776 899 dbSNP
rs1050233054 900 dbSNP
rs904464360 901 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggggugguGGUGCGGGc 5'
                   |||||||| 
Target 5' --------cCCACGCCCu 3'
 		1 - 10
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000437219.2 | 3UTR | CCCACGCCCUGGGUGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
44 hsa-miR-1268a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035845 POLR2I RNA polymerase II subunit I 1 1
MIRT035847 FASN fatty acid synthase 1 1
MIRT053736 SOX12 SRY-box 12 1 1
MIRT053737 CAMK2G calcium/calmodulin dependent protein kinase II gamma 1 1
MIRT473717 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT483654 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT484277 AIP aryl hydrocarbon receptor interacting protein 2 4
MIRT486674 WDR81 WD repeat domain 81 2 2
MIRT488672 WWP2 WW domain containing E3 ubiquitin protein ligase 2 2 4
MIRT493453 ITFG3 family with sequence similarity 234 member A 2 2
MIRT495902 ZNF641 zinc finger protein 641 2 2
MIRT500188 BARX1 BARX homeobox 1 2 4
MIRT512015 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT521134 SGPL1 sphingosine-1-phosphate lyase 1 2 4
MIRT530047 TRIM72 tripartite motif containing 72 2 2
MIRT531519 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT543736 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT558054 EVI5L ecotropic viral integration site 5 like 2 2
MIRT569603 TRIM29 tripartite motif containing 29 2 2
MIRT570027 FAM228A family with sequence similarity 228 member A 2 2
MIRT573595 CERS1 ceramide synthase 1 2 2
MIRT623884 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT630000 PDE6B phosphodiesterase 6B 2 2
MIRT632716 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT633497 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 1
MIRT637076 SELPLG selectin P ligand 2 2
MIRT638183 TLN1 talin 1 2 2
MIRT638767 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT668073 GMPS guanine monophosphate synthase 2 2
MIRT669874 RAET1E retinoic acid early transcript 1E 2 2
MIRT670664 KIAA1551 KIAA1551 2 2
MIRT671283 RPL37A ribosomal protein L37a 2 2
MIRT675055 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT682784 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT683344 SCARF1 scavenger receptor class F member 1 2 2
MIRT690283 ZNF154 zinc finger protein 154 2 2
MIRT695172 SLC25A33 solute carrier family 25 member 33 2 2
MIRT695222 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700485 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700601 PRKCA protein kinase C alpha 2 2
MIRT701410 NKRF NFKB repressing factor 2 2
MIRT703995 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT711232 RETSAT retinol saturase 2 2
MIRT719510 TMEM175 transmembrane protein 175 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1268a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1268a Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-1268a Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-1268a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved resistant High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1268a Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-1268a Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1268a Temozolomide 5394 NSC362856 approved sensitive Low Glioblastoma cell line (U87, LN229)
hsa-miR-1268a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (2uM)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Breast Cancer cell line (BCap37)
hsa-miR-1268a Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-mir-1268a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1268a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-1268a Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1268a Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-1268a Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1268a Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-1268a Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1268a Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1268a Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1268a Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine sensitive cell line (Bats-72)
hsa-miR-1268a Cisplatin 5460033 NSC119875 approved resistant cell line (MDAH-2774)

Error report submission