pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4660 |
Genomic Coordinates | chr8: 9048445 - 9048518 |
Description | Homo sapiens miR-4660 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4660 | |||||||||||||||
Sequence | 9| UGCAGCUCUGGUGGAAAAUGGAG |31 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HLA-B | ||||||||||||||||||||
Synonyms | AS, B-4901, HLAB | ||||||||||||||||||||
Description | major histocompatibility complex, class I, B | ||||||||||||||||||||
Transcript | NM_005514 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HLA-B | |||||||||||||||||||||
3'UTR of HLA-B (miRNA target sites are highlighted) |
>HLA-B|NM_005514|3'UTR 1 AAAGCCTGAGACAGCTGTCTTGTGAGGGACTGAGATGCAGGATTTCTTCACGCCTCCCCTTTGTGACTTCAAGAGCCTCT 81 GGCATCTCTTTCTGCAAAGGCACCTGAATGTGTCTGCGTCCCTGTTAGCATAATGTGAGGAGGTGGAGAGACAGCCCACC 161 CTTGTGTCCACTGTGACCCCTGTTCCCATGCTGACCTGTGTTTCCTCCCCAGTCATCTTTCTTGTTCCAGAGAGGTGGGG 241 CTGGATGTCTCCATCTCTGTCTCAACTTTACGTGCACTGAGCTGCAACTTCTTACTTCCCTACTGAAAATAAGAATCTGA 321 ATATAAATTTGTTTTCTCAAATATTTGCTATGAGAGGTTGATGGATTAATTAAATAAGTCAATTCCTGGAATTTGAGAGA 401 GCAAATAAAGACCTGAGAACCTTCCAGAATCTGCAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000412585.2 | 3UTR | CAACUUCUUACUUCCCUACUGAAAAUAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
73 hsa-miR-4660 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT064842 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 4 | ||||||||
MIRT090784 | MBNL1 | muscleblind like splicing regulator 1 | 2 | 2 | ||||||||
MIRT163239 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 | 2 | 2 | ||||||||
MIRT214144 | LMNB1 | lamin B1 | 2 | 2 | ||||||||
MIRT292479 | ZNF507 | zinc finger protein 507 | 2 | 2 | ||||||||
MIRT306038 | SKIL | SKI like proto-oncogene | 2 | 2 | ||||||||
MIRT310459 | REST | RE1 silencing transcription factor | 2 | 2 | ||||||||
MIRT329710 | SCD | stearoyl-CoA desaturase | 2 | 2 | ||||||||
MIRT457833 | ITPRIP | inositol 1,4,5-trisphosphate receptor interacting protein | 2 | 2 | ||||||||
MIRT460747 | SRP14 | signal recognition particle 14 | 2 | 2 | ||||||||
MIRT461545 | ACTR3B | ARP3 actin related protein 3 homolog B | 2 | 4 | ||||||||
MIRT486956 | HLA-B | major histocompatibility complex, class I, B | 2 | 2 | ||||||||
MIRT487933 | HLA-C | major histocompatibility complex, class I, C | 2 | 2 | ||||||||
MIRT490515 | LIMD1 | LIM domains containing 1 | 2 | 2 | ||||||||
MIRT492314 | SETD1B | SET domain containing 1B | 2 | 2 | ||||||||
MIRT501513 | PPTC7 | PTC7 protein phosphatase homolog | 2 | 6 | ||||||||
MIRT504616 | PLK1 | polo like kinase 1 | 2 | 2 | ||||||||
MIRT505714 | SESN2 | sestrin 2 | 2 | 2 | ||||||||
MIRT506199 | PHF19 | PHD finger protein 19 | 2 | 2 | ||||||||
MIRT506827 | KIF23 | kinesin family member 23 | 2 | 6 | ||||||||
MIRT512815 | ARRDC2 | arrestin domain containing 2 | 2 | 4 | ||||||||
MIRT527014 | MAGI2 | membrane associated guanylate kinase, WW and PDZ domain containing 2 | 2 | 4 | ||||||||
MIRT528520 | SLC1A7 | solute carrier family 1 member 7 | 2 | 2 | ||||||||
MIRT531346 | PLEKHG4B | pleckstrin homology and RhoGEF domain containing G4B | 2 | 2 | ||||||||
MIRT537154 | GID8 | GID complex subunit 8 homolog | 2 | 2 | ||||||||
MIRT541104 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | 2 | 2 | ||||||||
MIRT543397 | DROSHA | drosha ribonuclease III | 2 | 2 | ||||||||
MIRT551860 | ASB6 | ankyrin repeat and SOCS box containing 6 | 2 | 2 | ||||||||
MIRT554775 | RHEBP1 | RHEB pseudogene 1 | 2 | 4 | ||||||||
MIRT556479 | LIPA | lipase A, lysosomal acid type | 2 | 2 | ||||||||
MIRT556662 | KMT2D | lysine methyltransferase 2D | 2 | 4 | ||||||||
MIRT558213 | EFCAB14 | EF-hand calcium binding domain 14 | 2 | 4 | ||||||||
MIRT558819 | CDCA4 | cell division cycle associated 4 | 2 | 4 | ||||||||
MIRT559142 | BTN3A3 | butyrophilin subfamily 3 member A3 | 2 | 2 | ||||||||
MIRT560981 | ZNF333 | zinc finger protein 333 | 2 | 2 | ||||||||
MIRT562066 | KLHL15 | kelch like family member 15 | 2 | 2 | ||||||||
MIRT564703 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | 2 | 2 | ||||||||
MIRT565904 | SCAMP2 | secretory carrier membrane protein 2 | 2 | 2 | ||||||||
MIRT566320 | POTEM | POTE ankyrin domain family member M | 2 | 2 | ||||||||
MIRT566331 | POTEG | POTE ankyrin domain family member G | 2 | 2 | ||||||||
MIRT575253 | Timp3 | tissue inhibitor of metalloproteinase 3 | 2 | 2 | ||||||||
MIRT609975 | HERPUD2 | HERPUD family member 2 | 2 | 2 | ||||||||
MIRT614318 | C1orf220 | chromosome 1 open reading frame 220 | 2 | 2 | ||||||||
MIRT618784 | AGTRAP | angiotensin II receptor associated protein | 2 | 2 | ||||||||
MIRT619894 | NPTXR | neuronal pentraxin receptor | 2 | 2 | ||||||||
MIRT631517 | CTBS | chitobiase | 2 | 2 | ||||||||
MIRT640707 | MRS2 | MRS2, magnesium transporter | 2 | 2 | ||||||||
MIRT642218 | RUVBL2 | RuvB like AAA ATPase 2 | 2 | 2 | ||||||||
MIRT654661 | PSMG1 | proteasome assembly chaperone 1 | 2 | 2 | ||||||||
MIRT663725 | GLUL | glutamate-ammonia ligase | 2 | 2 | ||||||||
MIRT690653 | RPF2 | ribosome production factor 2 homolog | 2 | 2 | ||||||||
MIRT703189 | GPBP1 | GC-rich promoter binding protein 1 | 2 | 2 | ||||||||
MIRT705896 | ADCY9 | adenylate cyclase 9 | 2 | 2 | ||||||||
MIRT706984 | XPO5 | exportin 5 | 2 | 2 | ||||||||
MIRT710566 | KIAA1958 | KIAA1958 | 2 | 2 | ||||||||
MIRT712526 | CYTH2 | cytohesin 2 | 2 | 2 | ||||||||
MIRT714072 | RUNDC3B | RUN domain containing 3B | 2 | 2 | ||||||||
MIRT716299 | PAX1 | paired box 1 | 2 | 2 | ||||||||
MIRT716748 | C19orf24 | chromosome 19 open reading frame 24 | 2 | 2 | ||||||||
MIRT716933 | FAM13A | family with sequence similarity 13 member A | 2 | 2 | ||||||||
MIRT717344 | RAB40A | RAB40A, member RAS oncogene family | 2 | 2 | ||||||||
MIRT717387 | PTPRF | protein tyrosine phosphatase, receptor type F | 2 | 2 | ||||||||
MIRT718298 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | 2 | 2 | ||||||||
MIRT718569 | SLC25A22 | solute carrier family 25 member 22 | 2 | 2 | ||||||||
MIRT718642 | NKPD1 | NTPase KAP family P-loop domain containing 1 | 2 | 2 | ||||||||
MIRT718690 | BTBD9 | BTB domain containing 9 | 2 | 2 | ||||||||
MIRT719650 | ARL3 | ADP ribosylation factor like GTPase 3 | 2 | 2 | ||||||||
MIRT721035 | TRIM67 | tripartite motif containing 67 | 2 | 2 | ||||||||
MIRT721130 | TLK1 | tousled like kinase 1 | 2 | 2 | ||||||||
MIRT722968 | SLC25A26 | solute carrier family 25 member 26 | 2 | 2 | ||||||||
MIRT723114 | ZSCAN16 | zinc finger and SCAN domain containing 16 | 2 | 2 | ||||||||
MIRT723708 | RNF166 | ring finger protein 166 | 2 | 2 | ||||||||
MIRT736594 | MAFG | MAF bZIP transcription factor G | 3 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|