pre-miRNA Information
pre-miRNA hsa-mir-3180-1   
Genomic Coordinates chr16: 14911220 - 14911313
Description Homo sapiens miR-3180-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-2   
Genomic Coordinates chr16: 16309879 - 16309966
Description Homo sapiens miR-3180-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-3   
Genomic Coordinates chr16: 18402178 - 18402271
Description Homo sapiens miR-3180-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3180-3p
Sequence 62| UGGGGCGGAGCUUCCGGAGGCC |83
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C3orf36   
Synonyms -
Description chromosome 3 open reading frame 36
Transcript NM_025041   
Expression
Putative miRNA Targets on C3orf36
3'UTR of C3orf36
(miRNA target sites are highlighted)
>C3orf36|NM_025041|3'UTR
   1 AACGGCTTCTACTCCGGCCCCCAGTGTGACTAATCTCCTTCTCTTCGCTCCACAGGTCTATAAATGGGCCACAGTAGGCA
  81 CCCCTTTTTAAATCTGTAAAATCCCCAAATCCATTAAAAGTGACTTCAGAGGTCCCAGATAGGGACCAACATTTGTTTAA
 161 AAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ccGGAGGCCUUCGAGGCGGGGu 5'
            |||:|     ||:|||:|| 
Target 5' ctCCTTC----TCTTCGCTCCa 3'
35 - 52 122.00 -20.70
2
miRNA  3' ccGGAGGCCUUCGAGGCGGGGu 5'
            |:||:   | ||||| ||| 
Target 5' ggCTTCT---A-CTCCGGCCCc 3'
4 - 21 120.00 -23.70
3
miRNA  3' ccGGAGGCCUUCGAGGCGGGGu 5'
            || | | |:|   | |||| 
Target 5' ggCCACAGTAGG---CACCCCt 3'
67 - 85 92.00 -15.50
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ccggaggccuucGAGGCGGGGu 5'
                      ||||||| | 
Target 5' -----------cCUCCGCCGCg 3'
1 - 11
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000408895.2 | 3UTR | CCUCCGCCGCGGCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
66 hsa-miR-3180-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT133792 SKI SKI proto-oncogene 2 2
MIRT146658 MINK1 misshapen like kinase 1 2 4
MIRT441337 C19orf26 CACN beta subunit associated regulatory protein 2 4
MIRT449088 XPO6 exportin 6 2 2
MIRT464967 TULP1 tubby like protein 1 2 6
MIRT471706 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT473252 MIDN midnolin 2 2
MIRT483494 STMN3 stathmin 3 2 4
MIRT483726 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT485684 CCDC64 BICD family like cargo adaptor 1 2 4
MIRT486046 WSCD1 WSC domain containing 1 2 4
MIRT486522 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486779 SESTD1 SEC14 and spectrin domain containing 1 2 4
MIRT486852 DPF1 double PHD fingers 1 2 2
MIRT487035 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487082 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT487284 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 4
MIRT487992 RXRB retinoid X receptor beta 2 2
MIRT488101 POU3F1 POU class 3 homeobox 1 2 2
MIRT488547 POU3F3 POU class 3 homeobox 3 2 8
MIRT488582 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488757 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489217 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489350 SYNGR1 synaptogyrin 1 2 4
MIRT489385 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489459 MSC musculin 2 2
MIRT489469 SLITRK5 SLIT and NTRK like family member 5 2 2
MIRT489749 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT490244 MFI2 melanotransferrin 2 2
MIRT490423 VPS51 VPS51, GARP complex subunit 2 4
MIRT490644 FEM1A fem-1 homolog A 2 2
MIRT491977 UNK unkempt family zinc finger 2 2
MIRT492469 RASD1 ras related dexamethasone induced 1 2 4
MIRT492837 NRGN neurogranin 2 2
MIRT492956 NEUROD2 neuronal differentiation 2 2 2
MIRT493002 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT493430 KCNK3 potassium two pore domain channel subfamily K member 3 2 2
MIRT493709 H2AFX H2A histone family member X 2 6
MIRT493886 FAM43A family with sequence similarity 43 member A 2 4
MIRT493955 ENG endoglin 2 2
MIRT500168 MSI1 musashi RNA binding protein 1 2 2
MIRT500196 MAPK8IP3 mitogen-activated protein kinase 8 interacting protein 3 2 4
MIRT500366 ZNF385A zinc finger protein 385A 2 2
MIRT501159 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501698 PCGF3 polycomb group ring finger 3 2 6
MIRT512173 CASP16 caspase 16, pseudogene 2 6
MIRT512237 ATG2A autophagy related 2A 2 6
MIRT512879 PITX3 paired like homeodomain 3 2 2
MIRT531184 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT548362 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT569093 FSCN1 fascin actin-bundling protein 1 2 2
MIRT574133 MARVELD1 MARVEL domain containing 1 2 2
MIRT635542 LEPROTL1 leptin receptor overlapping transcript like 1 2 2
MIRT654098 RSBN1L round spermatid basic protein 1 like 2 2
MIRT664919 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT669843 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT670502 LYRM4 LYR motif containing 4 2 2
MIRT670526 SLC9A7 solute carrier family 9 member A7 2 2
MIRT670550 SHISA2 shisa family member 2 2 2
MIRT671031 PCDHB2 protocadherin beta 2 2 2
MIRT695219 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT700129 RNF144B ring finger protein 144B 2 2
MIRT709280 MAPK8IP2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT712750 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT720753 FAM193A family with sequence similarity 193 member A 2 2
MIRT724920 VPS18 VPS18, CORVET/HOPS core subunit 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3180 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3180 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-3180 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant Low Gastric Cancer cell line (MGC-803)
hsa-miR-3180-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3180-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-3180-3p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission