>SLC38A9|NM_173514|3'UTR
   1 AATACCTCAACTGTTTTTTTCAAGAGCTCTCATGATATTTTGAGCCTTGACAACAGTTCTATATAAATTCACTTGTAAAT
  81 GCTGCTGTTGTGTAATTCTAAATATTTTCTAAGATAATTTGAAAGCAAGGGAAATAGTGGCCCCTTAATGAGTATTTTTT
 161 TATTGGGGTGGGGAAAGGGGCAAAAAGAATGATCTTAGTGTCTTTACCTTTCTCATATTAACTCACCTCTTTATTCTGTG
 241 GTCTTTTCTGAATAGAAATGTATGCCCTAGGAAGAAATCATGCTGGGTTTTGCTTTTAGAGATAAAAGGTGGTGGATTTA
 321 TTTTGCCTGCAGTAAAGATTCTCAGGGTGTCAGAGCAGCATATTGTCAAATCCTGCTTCTGTTTTATGTTTCAGTGTATT
 401 CACTTTCATTTTCTTACTTACTAGACCATTTCTGCAGTTTGCCCAAACCTCTACTGTTTGGGACAGTAAGCCAAATACCT
 481 CATTTTTAAAAAGAAGTTTTCATGGCATCAGTGTTAATAAAGTACATTTTTAACTGAGTCTTAATCTCTATTTGAAGAAA
 561 AAGTAGAGACAAAAGTAATGTCAATGTAATCCCCAGGATCATGAAATGTATACAAAATAAATAAAGTAGGAGAGTTTGTT
 641 GCTGTCTAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' accacGUUUUCAUUAACACCAAAAa 5' :||||| :| |||| ||| Target 5' agagaTAAAAG--GTGGTGGATTTa 3'	298 - 320	132.00	-8.10
2	miRNA 3' accACG----UUUUCAUUA--AC-ACCAAAAa 5' ||| ::||| ||| || ||| ||| Target 5' gtaTGCCCTAGGAAGAAATCATGCTGGGTTTt 3'	260 - 291	130.00	-6.80
3	miRNA 3' accacguuuucAUUA-ACACCAAAAa 5' || | |||||| || Target 5' actcacctcttTATTCTGTGGTCTTt 3'	221 - 246	122.00	-6.20

Mutant ID	Mutant Position	Mutant Source
COSN30123024	1	COSMIC
COSN30117956	13	COSMIC
COSN30532984	31	COSMIC
COSN31578084	70	COSMIC
COSN18729907	141	COSMIC
COSN29552611	250	COSMIC
COSN31527495	342	COSMIC
COSN5077585	349	COSMIC
COSN31524459	505	COSMIC
COSN2110805	560	COSMIC
COSN7947315	582	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs753197808	4	dbSNP
rs765360292	6	dbSNP
rs752106294	10	dbSNP
rs754993535	10	dbSNP
rs376520502	11	dbSNP
rs754133453	12	dbSNP
rs1197519996	13	dbSNP
rs1251109215	14	dbSNP
rs764692493	15	dbSNP
rs766473368	16	dbSNP
rs761268860	21	dbSNP
rs1364383231	27	dbSNP
rs760543964	31	dbSNP
rs796444261	32	dbSNP
rs1407006965	34	dbSNP
rs964666307	35	dbSNP
rs1383665071	36	dbSNP
rs773080808	37	dbSNP
rs201595862	42	dbSNP
rs751818960	42	dbSNP
rs1163879823	43	dbSNP
rs368705751	51	dbSNP
rs540004033	52	dbSNP
rs904495143	69	dbSNP
rs1163361636	80	dbSNP
rs540512916	87	dbSNP
rs376593731	92	dbSNP
rs752076098	98	dbSNP
rs1328012113	101	dbSNP
rs1363220293	103	dbSNP
rs34827272	110	dbSNP
rs1043649403	114	dbSNP
rs1381887026	130	dbSNP
rs947938405	134	dbSNP
rs1326777652	140	dbSNP
rs895056446	146	dbSNP
rs75004233	150	dbSNP
rs903263429	157	dbSNP
rs186945071	167	dbSNP
rs1020285024	171	dbSNP
rs1484659054	172	dbSNP
rs879134083	173	dbSNP
rs1011624239	180	dbSNP
rs918370407	187	dbSNP
rs775970216	191	dbSNP
rs1430639738	208	dbSNP
rs892942293	215	dbSNP
rs3188223	229	dbSNP
rs1055572033	238	dbSNP
rs1484289111	254	dbSNP
rs539397322	260	dbSNP
rs937255954	262	dbSNP
rs1208614074	274	dbSNP
rs1343543411	279	dbSNP
rs139986823	292	dbSNP
rs1289648245	293	dbSNP
rs1045395204	314	dbSNP
rs1387494420	315	dbSNP
rs1401608710	320	dbSNP
rs940391632	325	dbSNP
rs941055512	326	dbSNP
rs909501063	327	dbSNP
rs1233841677	338	dbSNP
rs985717532	341	dbSNP
rs954312678	343	dbSNP
rs930395532	357	dbSNP
rs1397220732	359	dbSNP
rs1260932412	371	dbSNP
rs1297559735	375	dbSNP
rs920069794	381	dbSNP
rs1379302812	405	dbSNP
rs1287827682	407	dbSNP
rs1432785135	408	dbSNP
rs1209104930	415	dbSNP
rs922848524	420	dbSNP
rs976012326	424	dbSNP
rs964317752	434	dbSNP
rs976945059	435	dbSNP
rs1020323404	448	dbSNP
rs1406490956	451	dbSNP
rs1418566734	456	dbSNP
rs1390822479	460	dbSNP
rs987072074	464	dbSNP
rs956392799	465	dbSNP
rs1310793277	471	dbSNP
rs1159627693	477	dbSNP
rs557062977	478	dbSNP
rs369605090	479	dbSNP
rs568097441	481	dbSNP
rs67502985	484	dbSNP
rs893246050	490	dbSNP
rs1162981581	494	dbSNP
rs1318297040	502	dbSNP
rs1034174080	503	dbSNP
rs1279213021	507	dbSNP
rs1001808530	508	dbSNP
rs968754884	510	dbSNP
rs1425818700	526	dbSNP
rs1022953198	527	dbSNP
rs1231670792	539	dbSNP
rs1012865536	572	dbSNP
rs895090666	584	dbSNP
rs1056297966	614	dbSNP
rs1188071404	622	dbSNP
rs145634852	626	dbSNP
rs376416723	626	dbSNP
rs1250450172	628	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.