miRTarBase - #MIRT487343


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol HLA-DRA   
Synonyms HLA-DRA1
Description major histocompatibility complex, class II, DR alpha
Transcript NM_019111   
Expression
Putative miRNA Targets on HLA-DRA
3'UTR of HLA-DRA
(miRNA target sites are highlighted)		 
>HLA-DRA|NM_019111|3'UTR
   1 GGCACATGGAGGTGATGGTGTTTCTTAGAGAGAAGATCACTGAAGAAACTTCTGCTTTAATGGCTTTACAAAGCTGGCAA
  81 TATTACAATCCTTGACCTCAGTGAAAGCAGTCATCTTCAGCATTTTCCAGCCCTATAGCCACCCCAAGTGTGGATATGCC
 161 TCTTCGATTGCTCCGTACTCTAACATCTAGCTGGCTTCCCTGTCTATTGCCTTTTCCTGTATCTATTTTCCTCTATTTCC
 241 TATCATTTTATTATCACCATGCAATGCCTCTGGAATAAAACATACAGGAGTCTGTCTCTGCTATGGAATGCCCCATGGGG
 321 CATCTCTTGTGTACTTATTGTTTAAGGTTTCCTCAAACTGTGATTTTTCTGAACACAATAAACTATTTTGATGATCTTGG
 401 GTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaGUUCCAGGC----GACACUUGUGc 5'
            |||  | :|    :| ||||||| 
Target 5' ctCAAACTGTGATTTTTCTGAACACa 3'
 352 - 377 146.00 -8.30
2 
miRNA  3' uaguucCAGGCGACACUUGUGc 5'
                | || | ||||| :| 
Target 5' atccttGACCTCAGTGAAAGCa 3'
 88 - 109 108.00 -6.16
3 
miRNA  3' uaGUUCCAGGCGACACUUGUGc 5'
            ||||      ||||:|:|: 
Target 5' ccCAAG------TGTGGATATg 3'
 143 - 158 104.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30486372 9 COSMIC
COSN28670171 44 COSMIC
COSN1331472 136 COSMIC
COSN21453768 217 COSMIC
COSN18779933 309 COSMIC
COSN28031157 319 COSMIC
COSN5629273 441 COSMIC
COSN20091364 874 COSMIC
COSN4858797 982 COSMIC
COSN9780642 1089 COSMIC
rs2239802 160 GWAS
rs4935356 702 GWAS
rs3177928 749 GWAS
rs3177928 x rs234779 749 GWAS
rs7194 794 GWAS
rs7195 853 GWAS
rs1051336 906 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1001627549 7 dbSNP
rs916851071 11 dbSNP
rs1370757899 12 dbSNP
rs755226372 16 dbSNP
rs879058172 17 dbSNP
rs878981056 18 dbSNP
rs779308837 20 dbSNP
rs1396471188 22 dbSNP
rs16822632 26 dbSNP
rs375429096 39 dbSNP
rs3129888 40 dbSNP
rs747520598 41 dbSNP
rs373187293 45 dbSNP
rs1209199905 46 dbSNP
rs780623107 49 dbSNP
rs1255712774 51 dbSNP
rs745818672 56 dbSNP
rs1430438771 63 dbSNP
rs1417630961 71 dbSNP
rs878906609 77 dbSNP
rs751570344 87 dbSNP
rs923351154 88 dbSNP
rs1474926417 103 dbSNP
rs966631715 116 dbSNP
rs2239803 147 dbSNP
rs1459897540 157 dbSNP
rs2239802 160 dbSNP
rs1270381164 176 dbSNP
rs183243603 182 dbSNP
rs974552920 188 dbSNP
rs941958282 190 dbSNP
rs1317578063 200 dbSNP
rs556898835 203 dbSNP
rs897488898 208 dbSNP
rs1416405264 211 dbSNP
rs112114865 226 dbSNP
rs1051885539 227 dbSNP
rs908104316 234 dbSNP
rs1035862549 245 dbSNP
rs1037792573 247 dbSNP
rs1448389472 250 dbSNP
rs1387356463 256 dbSNP
rs894207222 257 dbSNP
rs1442605940 266 dbSNP
rs569226490 270 dbSNP
rs869104989 270 dbSNP
rs1376071942 274 dbSNP
rs1002014506 278 dbSNP
rs1249149964 279 dbSNP
rs1012603336 282 dbSNP
rs368129166 284 dbSNP
rs5014616 284 dbSNP
rs375668727 285 dbSNP
rs532328824 285 dbSNP
rs895909899 285 dbSNP
rs1308264194 288 dbSNP
rs1393668632 297 dbSNP
rs1448670604 298 dbSNP
rs1285799019 308 dbSNP
rs1371223469 308 dbSNP
rs796443832 308 dbSNP
rs368104009 309 dbSNP
rs1376673303 310 dbSNP
rs1297647443 315 dbSNP
rs1023788031 317 dbSNP
rs386699336 317 dbSNP
rs539718048 318 dbSNP
rs115317719 319 dbSNP
rs1014227372 325 dbSNP
rs1384406739 335 dbSNP
rs1159697729 343 dbSNP
rs980131346 345 dbSNP
rs1248395710 353 dbSNP
rs1318811738 355 dbSNP
rs1490390267 356 dbSNP
rs1270504366 357 dbSNP
rs1219813653 368 dbSNP
rs1031218760 369 dbSNP
rs956933724 386 dbSNP
rs188726318 389 dbSNP
rs976085104 393 dbSNP
rs1306982288 423 dbSNP
rs71565323 428 dbSNP
rs1347485502 431 dbSNP
rs974880187 444 dbSNP
rs193297360 454 dbSNP
rs986205308 465 dbSNP
rs987061317 471 dbSNP
rs1455206936 478 dbSNP
rs1361992212 486 dbSNP
rs1158344214 491 dbSNP
rs1480444049 494 dbSNP
rs1471995246 505 dbSNP
rs1430816224 510 dbSNP
rs1187627441 511 dbSNP
rs1423918459 515 dbSNP
rs574408863 533 dbSNP
rs767691724 541 dbSNP
rs1490075436 544 dbSNP
rs1207245000 545 dbSNP
rs1262048788 545 dbSNP
rs1485134229 555 dbSNP
rs1168005122 562 dbSNP
rs940943197 566 dbSNP
rs541860472 567 dbSNP
rs973657126 569 dbSNP
rs909082480 576 dbSNP
rs1223036534 582 dbSNP
rs941801219 590 dbSNP
rs752317777 592 dbSNP
rs867375287 593 dbSNP
rs9281809 593 dbSNP
rs73729230 595 dbSNP
rs897715309 597 dbSNP
rs937504497 598 dbSNP
rs938366837 599 dbSNP
rs1319746496 605 dbSNP
rs142023569 610 dbSNP
rs1447046105 611 dbSNP
rs895866959 614 dbSNP
rs1173605154 626 dbSNP
rs1278537959 631 dbSNP
rs1341365219 633 dbSNP
rs1220691409 636 dbSNP
rs1427060839 641 dbSNP
rs894133744 648 dbSNP
rs1184637904 653 dbSNP
rs1463030734 672 dbSNP
rs1276448667 682 dbSNP
rs1203112969 685 dbSNP
rs115857426 694 dbSNP
rs564163628 701 dbSNP
rs4935356 702 dbSNP
rs1296554513 704 dbSNP
rs3135390 709 dbSNP
rs4935354 712 dbSNP
rs550585478 719 dbSNP
rs1210626886 724 dbSNP
rs1413340133 726 dbSNP
rs1264346753 730 dbSNP
rs1012655688 747 dbSNP
rs3177928 749 dbSNP
rs3191043 770 dbSNP
rs1389220622 773 dbSNP
rs1184582746 776 dbSNP
rs1446896607 783 dbSNP
rs7194 794 dbSNP
rs1187481334 805 dbSNP
rs1051015 846 dbSNP
rs777586636 852 dbSNP
rs7195 853 dbSNP
rs1194187442 855 dbSNP
rs567006522 865 dbSNP
rs1292852994 869 dbSNP
rs1246432420 874 dbSNP
rs987219934 879 dbSNP
rs1131541 880 dbSNP
rs1447242412 883 dbSNP
rs7196 885 dbSNP
rs1330287388 887 dbSNP
rs7197 894 dbSNP
rs1362204268 896 dbSNP
rs1402130325 897 dbSNP
rs1163838105 905 dbSNP
rs1051336 906 dbSNP
rs976725617 908 dbSNP
rs937599809 926 dbSNP
rs991632602 938 dbSNP
rs1234080451 950 dbSNP
rs1276625760 954 dbSNP
rs1163143779 958 dbSNP
rs1470779191 961 dbSNP
rs1366103894 963 dbSNP
rs557028220 966 dbSNP
rs950105583 971 dbSNP
rs1269785548 976 dbSNP
rs111471704 980 dbSNP
rs188003551 988 dbSNP
rs1490764844 989 dbSNP
rs1234190131 999 dbSNP
rs903165614 1006 dbSNP
rs1287255820 1008 dbSNP
rs1351295044 1010 dbSNP
rs935964121 1030 dbSNP
rs953354820 1031 dbSNP
rs1303333091 1042 dbSNP
rs781366068 1045 dbSNP
rs1406421694 1052 dbSNP
rs1052531 1055 dbSNP
rs1063590 1057 dbSNP
rs893688624 1061 dbSNP
rs986215091 1065 dbSNP
rs1401705562 1068 dbSNP
rs1387773163 1069 dbSNP
rs866495193 1077 dbSNP
rs1157343109 1079 dbSNP
rs996497312 1091 dbSNP
rs1430097656 1095 dbSNP
rs1052916 1100 dbSNP
rs1053043 1106 dbSNP
rs1201735629 1118 dbSNP
rs1041885 1123 dbSNP
rs1246406737 1124 dbSNP
rs890318115 1126 dbSNP
rs112637929 1137 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaguuccaggcGACACUugugc 5'
                     ||||||     
Target 5' -uuuccucaaaCUGUGAuuuuu 3'
 		1 - 21
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000395388.2 | 3UTR | UUUCCUCAAACUGUGAUUUUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.438 1.4e-2 -0.385 2.9e-2 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.28 9.3e-2 0.361 4.2e-2 24 Click to see details
GSE28544 Breast cancer -0.256 1.1e-1 -0.278 9.4e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.218 1.2e-1 -0.203 1.3e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.371 1.2e-1 0.573 2.6e-2 12 Click to see details
GSE21687 Ependynoma primary tumors -0.13 1.5e-1 -0.136 1.4e-1 64 Click to see details
GSE38226 Liver fibrosis 0.193 2.0e-1 0.178 2.2e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.155 2.4e-1 0.268 1.1e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.144 2.7e-1 -0.236 1.6e-1 20 Click to see details
GSE28260 Renal cortex and medulla 0.04 4.5e-1 -0.071 4.1e-1 13 Click to see details
GSE28260 Renal cortex and medulla 0.04 4.5e-1 -0.071 4.1e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
0.04 4.5e-1 -0.071 4.1e-1 13 Click to see details
0.04 4.5e-1 -0.071 4.1e-1 13 Click to see details
0.04 4.5e-1 -0.071 4.1e-1 13 Click to see details
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission