pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-383 |
Genomic Coordinates | chr8: 14853438 - 14853510 |
Synonyms | MIRN383, hsa-mir-383, MIR383 |
Description | Homo sapiens miR-383 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-383-5p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 7| AGAUCAGAAGGUGAUUGUGGCU |28 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NRF1 | ||||||||||||||||||||
Synonyms | ALPHA-PAL | ||||||||||||||||||||
Description | nuclear respiratory factor 1 | ||||||||||||||||||||
Transcript | NM_001040110 | ||||||||||||||||||||
Other Transcripts | NM_005011 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NRF1 | |||||||||||||||||||||
3'UTR of NRF1 (miRNA target sites are highlighted) |
>NRF1|NM_001040110|3'UTR 1 CATACAGCCATATTATGGCATCGTTTTCTAGTCTACTTCAAAATTTTTTACACGTTTGCAGAGGTGCAATCAAATGGAAT 81 TAAGTCTCTCGACTTTGGAAGGAAAGTTTTGTTAACCTTTTTTTTTTTAAAAGGAAGAAAGCGGATTTTGGAATTGCATT 161 TTTTAAAGCACCACTCTTGATTTTCTGGGATTGGTGAAGAAACTGCATTGTCAATTTCACTGTCCCAAAAAAGCCAAATT 241 GTGGCAGGACTTCTTTCTGCGGAAATGTGTGTGTATACTTATGTGTGTGTATGTGTGAGTGTGAATATATGTATATGTGT 321 ACATATGGACATACACATTTACATATATATAAAGTATATATATACATATATATATATATATATGTATGAAACCCGCATGG 401 AATTATCTGTATGAAATCAAGGTGCGCTGTGGAAACAATAATTCACCCAGTTTAGTGGGTGGTAGGGTACGTGGCCAGAC 481 ACAGTCACCCAGTTTTTGTTCATACCAGGGTCATGCGTTGAGCTACTGACAAACTCAGGCGGAGGTGACCATGCCCTTCA 561 CCAAAGCTGCCTCCCAGTGGCCACACAGAACTCTCCCTGCTGGACTCACCTGAGGAAAGAGGCTCCAGCATGGGGTGGGT 641 CAGAGATGTGCTTGCAAGGTCCAGGGACTGCGTGGTCTGCCAGCTGAGATGCTCCTCGGGCTGGCCCAGGTGCTGACCTT 721 GCCACAGGCAGATGAATGTCTTGAAAGCTCCCGGGCCTCAGCCTCCCATCTCCTCTCCTTCCCAGGAATCCTTGATCTCA 801 TGACTATTAAAATGTTGCTCTGGTTTTAAGGTCAGTCCTGAATTGCTCGTATATATGAACTGAAGGTAACCGAAGTATTA 881 GGGGTTTGAGGAGTGCGTGCGTGTAAGTGTGCTTGTGTGTGTGCGTGCATGGTGGGGGAGAGGATGGGAAGGGGGCGGGG 961 GCAGTGGAAGGGAAAGGAAGGAAAGAAAAATCGTCCTAGACCAGGATACACCCGTGGGAGCAATTTTCTCTACTGTCTGT 1041 AGCTTCACAGAGGAGGCGCTGGAATGAACAAGAAGAGACATCTGGTCTGTGGCCACAGCACCCTGAACGCCCCTGATCTT 1121 GTGTGATCTTGGAAGCTAAGCTTGGTTGGGCCCGGTCAGTACGCGGAAGGGAAGAAGGGACACCTGGCCATAGAAAACAG 1201 CTGAGGGTGTTTGCTGTGTTCCTGGATCAGGCCCTGCTTCAGAAGGGACTCCTGGAGGCCCATGTTCCTTGATGCAACCT 1281 CGTGGCCCAGGCCGGGAGCAGCTTGCCTCCTCAGAGGTGTTGACTATCTGGGTGTTCTTGGTAACCGTTAACTCTGTCTT 1361 TCTCAGCTGCAAGCCCTGAGTCTCCAGTAGCTGAATTCACCTGACTTTTCAACAGGCCAAATCTCTGAACCTTGAGTACA 1441 GGGACAGCTCCTCCTCCCTCCTCCCAGCTCTCCCCATGTGTGTGATGGTGTATTTAATGTGTTTTTTTAATGCGACATTA 1521 AAAGATTCTCCACGTCTTGCTCAACCTTTGAGAGAAGTTTCAGATTCTTGTATTTGCTTGTTTTATATAAAACTATCTAA 1601 TGTTCTTTATATGTTCTTTTCTGTACGTAATGGGGGGAGGGGAGGGAAATTTACATATAAATAGTCCTAGTTCTACAATT 1681 TGTTATTTTTTTAATTATTATTTTTTATCGTCATTGTGAAGTTGTCCAGGGACTTTAAAGTCCATGTTCCTTTGTGGTGA 1761 AATAACCTCCAAATAGTTTGAGAAGTTGCCAAGACGAAGAAAAAAGCAAAACCCCAGTAGCAGAGCATGGATTCTGTGTT 1841 GTTTCCCATTCTGTCTTTGACTGCCTCATTCAATAAATAGTTAAAAATGTGGCAACAGGAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | hESCs (WA-09) |
Disease | 4899.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177631. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_9
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000393230.2 | 3UTR | CACCCUGAACGCCCCUGAUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000393230.2 | 3UTR | GUCUGUGGCCACAGCACCCUGAACGCCCCUGAUCUUGUGUGAUCUUGGAAGCUAAGCUUGGUUGGGCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000393230.2 | 3UTR | CACCCUGAACGCCCCUGAUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
96 hsa-miR-383-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT004443 | VEGFA | vascular endothelial growth factor A | 5 | 2 | ||||||||
MIRT006137 | DIO1 | iodothyronine deiodinase 1 | 3 | 1 | ||||||||
MIRT006535 | IRF1 | interferon regulatory factor 1 | 3 | 1 | ||||||||
MIRT007246 | IGF1R | insulin like growth factor 1 receptor | 1 | 1 | ||||||||
MIRT007305 | PRDX3 | peroxiredoxin 3 | 1 | 1 | ||||||||
MIRT054359 | CCND1 | cyclin D1 | 4 | 2 | ||||||||
MIRT057087 | DDIT4 | DNA damage inducible transcript 4 | 2 | 2 | ||||||||
MIRT086536 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | 2 | 2 | ||||||||
MIRT086544 | MOB4 | MOB family member 4, phocein | 2 | 2 | ||||||||
MIRT438194 | PPP1R10 | protein phosphatase 1 regulatory subunit 10 | 3 | 1 | ||||||||
MIRT448282 | ZMYM2 | zinc finger MYM-type containing 2 | 2 | 2 | ||||||||
MIRT451601 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | 2 | 2 | ||||||||
MIRT453387 | RHD | Rh blood group D antigen | 2 | 2 | ||||||||
MIRT458521 | C5orf22 | chromosome 5 open reading frame 22 | 2 | 2 | ||||||||
MIRT459720 | SGK494 | uncharacterized serine/threonine-protein kinase SgK494 | 2 | 2 | ||||||||
MIRT461491 | KIAA1009 | centrosomal protein 162 | 1 | 1 | ||||||||
MIRT463261 | ZIC5 | Zic family member 5 | 2 | 2 | ||||||||
MIRT464237 | VCP | valosin containing protein | 2 | 2 | ||||||||
MIRT465320 | TRAF5 | TNF receptor associated factor 5 | 2 | 2 | ||||||||
MIRT465774 | TMOD3 | tropomodulin 3 | 2 | 2 | ||||||||
MIRT467879 | SLC22A23 | solute carrier family 22 member 23 | 2 | 2 | ||||||||
MIRT469636 | RAD21 | RAD21 cohesin complex component | 2 | 6 | ||||||||
MIRT472041 | NPAT | nuclear protein, coactivator of histone transcription | 2 | 2 | ||||||||
MIRT476568 | GABARAPL1 | GABA type A receptor associated protein like 1 | 2 | 2 | ||||||||
MIRT478586 | CTDSPL2 | CTD small phosphatase like 2 | 2 | 2 | ||||||||
MIRT478870 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT482202 | AHR | aryl hydrocarbon receptor | 2 | 2 | ||||||||
MIRT484237 | IER2 | immediate early response 2 | 2 | 2 | ||||||||
MIRT487480 | NRF1 | nuclear respiratory factor 1 | 2 | 6 | ||||||||
MIRT493746 | GRAP2 | GRB2-related adaptor protein 2 | 2 | 2 | ||||||||
MIRT496836 | ZNF460 | zinc finger protein 460 | 2 | 2 | ||||||||
MIRT497234 | APOL2 | apolipoprotein L2 | 2 | 2 | ||||||||
MIRT499424 | PLCG2 | phospholipase C gamma 2 | 2 | 9 | ||||||||
MIRT500598 | UBN2 | ubinuclein 2 | 2 | 10 | ||||||||
MIRT502859 | CHEK2 | checkpoint kinase 2 | 2 | 6 | ||||||||
MIRT507727 | CLIC4 | chloride intracellular channel 4 | 2 | 4 | ||||||||
MIRT510509 | YOD1 | YOD1 deubiquitinase | 2 | 6 | ||||||||
MIRT511901 | FNBP1L | formin binding protein 1 like | 2 | 6 | ||||||||
MIRT514393 | CLUAP1 | clusterin associated protein 1 | 2 | 2 | ||||||||
MIRT520180 | WBP2 | WW domain binding protein 2 | 2 | 4 | ||||||||
MIRT531214 | PLA2G4D | phospholipase A2 group IVD | 2 | 2 | ||||||||
MIRT532846 | ZNF699 | zinc finger protein 699 | 2 | 2 | ||||||||
MIRT533461 | TRIM71 | tripartite motif containing 71 | 2 | 2 | ||||||||
MIRT539263 | ANKRD44 | ankyrin repeat domain 44 | 2 | 2 | ||||||||
MIRT539380 | ADSS | adenylosuccinate synthase | 2 | 6 | ||||||||
MIRT548129 | GAS1 | growth arrest specific 1 | 2 | 2 | ||||||||
MIRT550662 | ZFP37 | ZFP37 zinc finger protein | 2 | 2 | ||||||||
MIRT551499 | CENPN | centromere protein N | 2 | 2 | ||||||||
MIRT553778 | TAF13 | TATA-box binding protein associated factor 13 | 2 | 2 | ||||||||
MIRT554376 | SFPQ | splicing factor proline and glutamine rich | 2 | 2 | ||||||||
MIRT555821 | PCDH11Y | protocadherin 11 Y-linked | 2 | 4 | ||||||||
MIRT557558 | GOSR1 | golgi SNAP receptor complex member 1 | 2 | 2 | ||||||||
MIRT557694 | GATA6 | GATA binding protein 6 | 2 | 2 | ||||||||
MIRT561383 | TWF1 | twinfilin actin binding protein 1 | 2 | 2 | ||||||||
MIRT561414 | TSN | translin | 2 | 2 | ||||||||
MIRT561867 | MSH6 | mutS homolog 6 | 2 | 2 | ||||||||
MIRT567383 | GTPBP3 | GTP binding protein 3, mitochondrial | 2 | 2 | ||||||||
MIRT569272 | PCDH11X | protocadherin 11 X-linked | 2 | 2 | ||||||||
MIRT569556 | UNC119B | unc-119 lipid binding chaperone B | 2 | 2 | ||||||||
MIRT569760 | RIMBP3C | RIMS binding protein 3C | 2 | 5 | ||||||||
MIRT573387 | GGA2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | 2 | 2 | ||||||||
MIRT573456 | RPL41 | ribosomal protein L41 | 2 | 2 | ||||||||
MIRT573968 | DDX21 | DExD-box helicase 21 | 2 | 2 | ||||||||
MIRT574163 | ATG10 | autophagy related 10 | 2 | 2 | ||||||||
MIRT574659 | KLHL15 | kelch like family member 15 | 2 | 2 | ||||||||
MIRT574907 | Plcg2 | phospholipase C, gamma 2 | 2 | 6 | ||||||||
MIRT607496 | HEBP2 | heme binding protein 2 | 2 | 2 | ||||||||
MIRT612840 | KCNJ12 | potassium voltage-gated channel subfamily J member 12 | 2 | 4 | ||||||||
MIRT613962 | TMEM59 | transmembrane protein 59 | 2 | 2 | ||||||||
MIRT621125 | PCNXL2 | pecanex homolog 2 | 2 | 2 | ||||||||
MIRT625216 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | 2 | 2 | ||||||||
MIRT643337 | MICA | MHC class I polypeptide-related sequence A | 2 | 2 | ||||||||
MIRT646342 | CLIC6 | chloride intracellular channel 6 | 2 | 2 | ||||||||
MIRT647361 | WDR5B | WD repeat domain 5B | 2 | 2 | ||||||||
MIRT650308 | SLC35E2 | solute carrier family 35 member E2 | 2 | 2 | ||||||||
MIRT651372 | ZBTB21 | zinc finger and BTB domain containing 21 | 2 | 2 | ||||||||
MIRT655301 | PEAR1 | platelet endothelial aggregation receptor 1 | 2 | 2 | ||||||||
MIRT681918 | SLC11A2 | solute carrier family 11 member 2 | 2 | 2 | ||||||||
MIRT684165 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | 2 | 2 | ||||||||
MIRT688053 | GLUL | glutamate-ammonia ligase | 2 | 2 | ||||||||
MIRT690210 | C5orf45 | MRN complex interacting protein | 2 | 2 | ||||||||
MIRT691024 | CRTC3 | CREB regulated transcription coactivator 3 | 2 | 2 | ||||||||
MIRT697699 | WAC | WW domain containing adaptor with coiled-coil | 2 | 2 | ||||||||
MIRT698201 | TMEM30A | transmembrane protein 30A | 2 | 2 | ||||||||
MIRT698857 | SRSF2 | serine and arginine rich splicing factor 2 | 2 | 2 | ||||||||
MIRT702292 | LDHA | lactate dehydrogenase A | 4 | 2 | ||||||||
MIRT703341 | GDPD5 | glycerophosphodiester phosphodiesterase domain containing 5 | 2 | 2 | ||||||||
MIRT704082 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | 2 | 2 | ||||||||
MIRT713729 | SUCO | SUN domain containing ossification factor | 2 | 2 | ||||||||
MIRT719487 | RBM27 | RNA binding motif protein 27 | 2 | 2 | ||||||||
MIRT722080 | SMC2 | structural maintenance of chromosomes 2 | 2 | 2 | ||||||||
MIRT724102 | TMEM199 | transmembrane protein 199 | 2 | 2 | ||||||||
MIRT725124 | SYNRG | synergin gamma | 2 | 2 | ||||||||
MIRT725601 | CAPN6 | calpain 6 | 2 | 2 | ||||||||
MIRT737186 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | 4 | 0 | ||||||||
MIRT755379 | NOS3 | nitric oxide synthase 3 | 3 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|