pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1273h |
Genomic Coordinates | chr16: 24203116 - 24203231 |
Description | Homo sapiens miR-1273h stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1273h-5p | |||||||||
Sequence | 33| CUGGGAGGUCAAGGCUGCAGU |53 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TM6SF2 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | transmembrane 6 superfamily member 2 | ||||||||||||||||||||
Transcript | NM_001001524 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TM6SF2 | |||||||||||||||||||||
3'UTR of TM6SF2 (miRNA target sites are highlighted) |
>TM6SF2|NM_001001524|3'UTR 1 GAGAGCTGTGGACTCAGGACCCAGGACTCTGTTTACGTGCCCAGTCAGCCCTACCTGGGGAAGCGGGGGTTGGGTGTTTT 81 AGAGACAGGAGGGACATCTCCGGGTGTCTTTAGTCTTGGCTATGGTAGTTTCAGTCCAGTGGGTGGGATGGAGACCAACG 161 ACCAAGTGTTCCTGCAAGGAGAGCCTCCCACAGCTGTCACCATGCTCCAACTCCCACACAAACGCTTCTACCCCTTCCAG 241 AACTTACCCATCATCCCCCCATGGATCCTTTCAGTAAAAACCCTTTCAATTTCCAAAAT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C8166 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000389363.4 | 3UTR | UCCCACAGCUGUCACCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000389363.4 | 3UTR | UCCCACAGCUGUCACCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000389363.4 | 3UTR | UCCCACAGCUGUCACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000389363.4 | 3UTR | UCCCACAGCUGUCACCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
494 hsa-miR-1273h-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT074355 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT100721 | TJAP1 | tight junction associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT115545 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT124982 | XIAP | X-linked inhibitor of apoptosis | ![]() |
![]() |
2 | 4 | ||||||
MIRT139911 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT177183 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 4 | ||||||
MIRT187994 | MBD6 | methyl-CpG binding domain protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT207410 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 6 | ||||||
MIRT241928 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT260110 | KLHL21 | kelch like family member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT260358 | XRCC6 | X-ray repair cross complementing 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT266428 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294663 | ZNF548 | zinc finger protein 548 | ![]() |
![]() |
2 | 2 | ||||||
MIRT351039 | PLEKHB2 | pleckstrin homology domain containing B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT379943 | PRRG4 | proline rich and Gla domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT398983 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441465 | BEST3 | bestrophin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446750 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449224 | RAD51B | RAD51 paralog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT450623 | AQR | aquarius intron-binding spliceosomal factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT451090 | ZNF584 | zinc finger protein 584 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451558 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451736 | CES3 | carboxylesterase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452411 | QDPR | quinoid dihydropteridine reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452559 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452851 | LAX1 | lymphocyte transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452922 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453043 | TANGO2 | transport and golgi organization 2 homolog | ![]() |
![]() |
2 | 4 | ||||||
MIRT453097 | HOXC4 | homeobox C4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453297 | ZNF394 | zinc finger protein 394 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453593 | ZNF557 | zinc finger protein 557 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453787 | KBTBD12 | kelch repeat and BTB domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453987 | CECR1 | adenosine deaminase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454083 | TMEM209 | transmembrane protein 209 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454652 | FBXL18 | F-box and leucine rich repeat protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454753 | PFKFB3 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455311 | TTLL9 | tubulin tyrosine ligase like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456468 | SERAC1 | serine active site containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456554 | TOMM20 | translocase of outer mitochondrial membrane 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456716 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 4 | ||||||
MIRT456796 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457487 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457999 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458130 | TLCD2 | TLC domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459027 | ZNF490 | zinc finger protein 490 | ![]() |
![]() |
2 | 4 | ||||||
MIRT459119 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459315 | HAVCR2 | hepatitis A virus cellular receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459385 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459412 | FAM83B | family with sequence similarity 83 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT459974 | RFT1 | RFT1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460480 | FAM105A | family with sequence similarity 105 member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT460586 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT460920 | NOA1 | nitric oxide associated 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461072 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT461590 | DPH2 | DPH2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT461854 | ZNF317 | zinc finger protein 317 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462176 | ACADL | acyl-CoA dehydrogenase, long chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT462446 | GCDH | glutaryl-CoA dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT463854 | WNT7B | Wnt family member 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464310 | UST | uronyl 2-sulfotransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT464815 | UBE2B | ubiquitin conjugating enzyme E2 B | ![]() |
![]() |
2 | 2 | ||||||
MIRT465453 | TOR2A | torsin family 2 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT466073 | TMEM184C | transmembrane protein 184C | ![]() |
![]() |
2 | 2 | ||||||
MIRT466514 | TBXA2R | thromboxane A2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT467072 | SRRD | SRR1 domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT469551 | RARA | retinoic acid receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT469741 | RAB2B | RAB2B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT470759 | PNPLA6 | patatin like phospholipase domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470875 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470976 | PITPNA | phosphatidylinositol transfer protein alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT471048 | PIM3 | Pim-3 proto-oncogene, serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT471215 | PHAX | phosphorylated adaptor for RNA export | ![]() |
![]() |
2 | 2 | ||||||
MIRT471246 | PGM2L1 | phosphoglucomutase 2 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471286 | PGAM4 | phosphoglycerate mutase family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471467 | PDE7B | phosphodiesterase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT473069 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT473989 | LRRC20 | leucine rich repeat containing 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474518 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474990 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475547 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476350 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477298 | EPHB2 | EPH receptor B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477933 | DPM2 | dolichyl-phosphate mannosyltransferase subunit 2, regulatory | ![]() |
![]() |
2 | 2 | ||||||
MIRT478282 | DDX19A | DEAD-box helicase 19A | ![]() |
![]() |
2 | 4 | ||||||
MIRT478472 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478559 | CTNND1 | catenin delta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478618 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478834 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479007 | COL5A1 | collagen type V alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT479166 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT482454 | ADAR | adenosine deaminase, RNA specific | ![]() |
![]() |
2 | 4 | ||||||
MIRT483019 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483798 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT486087 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486304 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486490 | MYH11 | myosin heavy chain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486881 | TSPYL4 | TSPY like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487125 | NCOR2 | nuclear receptor corepressor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487542 | TM6SF2 | transmembrane 6 superfamily member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487676 | B3GALT5 | beta-1,3-galactosyltransferase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489251 | TTLL1 | tubulin tyrosine ligase like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489276 | RBM8A | RNA binding motif protein 8A | ![]() |
![]() |
2 | 8 | ||||||
MIRT489496 | CRLF3 | cytokine receptor like factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489571 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489694 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490166 | TMEM63C | transmembrane protein 63C | ![]() |
![]() |
2 | 2 | ||||||
MIRT491199 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491260 | DHX40 | DEAH-box helicase 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491385 | HAUS3 | HAUS augmin like complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491548 | YAE1D1 | Yae1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492722 | PHF12 | PHD finger protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493866 | FAM73B | mitoguardin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494549 | BAK1 | BCL2 antagonist/killer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498586 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498722 | SNTN | sentan, cilia apical structure protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT499982 | HIST1H2BD | histone cluster 1 H2B family member d | ![]() |
![]() |
2 | 4 | ||||||
MIRT503414 | SLC25A45 | solute carrier family 25 member 45 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508491 | FTO | FTO, alpha-ketoglutarate dependent dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT508877 | METTL14 | methyltransferase like 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509622 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 4 | ||||||
MIRT510104 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT510139 | PDGFRA | platelet derived growth factor receptor alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT510353 | ZNF703 | zinc finger protein 703 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510620 | TMEM167A | transmembrane protein 167A | ![]() |
![]() |
2 | 4 | ||||||
MIRT510786 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511021 | NRF1 | nuclear respiratory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513925 | GHITM | growth hormone inducible transmembrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT514342 | DNAH17 | dynein axonemal heavy chain 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515015 | SUMF2 | sulfatase modifying factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515246 | DUSP28 | dual specificity phosphatase 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516202 | RPP30 | ribonuclease P/MRP subunit p30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516435 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516666 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518373 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518930 | LSG1 | large 60S subunit nuclear export GTPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519676 | ZNF70 | zinc finger protein 70 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519902 | ZFAND4 | zinc finger AN1-type containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519945 | ZCCHC8 | zinc finger CCHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520321 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT520606 | TMEM41B | transmembrane protein 41B | ![]() |
![]() |
2 | 2 | ||||||
MIRT520663 | TMEM11 | transmembrane protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520852 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT521443 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT521671 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT522281 | NKAP | NFKB activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT522333 | NCKIPSD | NCK interacting protein with SH3 domain | ![]() |
![]() |
2 | 8 | ||||||
MIRT522535 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523478 | GNG4 | G protein subunit gamma 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523672 | FOPNL | FGFR1OP N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT523715 | FBXW2 | F-box and WD repeat domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523867 | ESCO2 | establishment of sister chromatid cohesion N-acetyltransferase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524043 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524167 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT524928 | ALG10B | ALG10B, alpha-1,2-glucosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT526825 | PHC1 | polyhomeotic homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531017 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536085 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540681 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541708 | TMEM33 | transmembrane protein 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541755 | KLF8 | Kruppel like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541888 | LY6G5B | lymphocyte antigen 6 family member G5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT545714 | SPTLC2 | serine palmitoyltransferase long chain base subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559054 | C19orf47 | chromosome 19 open reading frame 47 | ![]() |
![]() |
2 | 4 | ||||||
MIRT561748 | PLAGL2 | PLAG1 like zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562365 | ETV3 | ETS variant 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562821 | GCFC2 | GC-rich sequence DNA-binding factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562900 | DNAH10OS | dynein axonemal heavy chain 10 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT564452 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT569111 | ONECUT3 | one cut homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569224 | SUSD1 | sushi domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570271 | ARPC3 | actin related protein 2/3 complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570498 | TFIP11 | tuftelin interacting protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570844 | GPRC5C | G protein-coupled receptor class C group 5 member C | ![]() |
![]() |
2 | 2 | ||||||
MIRT571311 | TPCN2 | two pore segment channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572077 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572116 | DNAJC24 | DnaJ heat shock protein family (Hsp40) member C24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573054 | TRIB1 | tribbles pseudokinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573483 | IQSEC3 | IQ motif and Sec7 domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573656 | HES6 | hes family bHLH transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574343 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576494 | Slc35e2 | solute carrier family 35, member E2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT608033 | UBLCP1 | ubiquitin like domain containing CTD phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611326 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613660 | KIAA1210 | KIAA1210 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615638 | ATF6 | activating transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618573 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT618865 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618962 | MRPS16 | mitochondrial ribosomal protein S16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619172 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620298 | AQP6 | aquaporin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620683 | RFTN2 | raftlin family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621637 | UBXN2B | UBX domain protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT621993 | STK4 | serine/threonine kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622421 | NUDT19 | nudix hydrolase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622804 | PGAM5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | ![]() |
![]() |
2 | 4 | ||||||
MIRT624786 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624968 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT625479 | SMAD9 | SMAD family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626594 | ACAA2 | acetyl-CoA acyltransferase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626708 | TRIM65 | tripartite motif containing 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626975 | LINC00598 | long intergenic non-protein coding RNA 598 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627489 | STRIP2 | striatin interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628505 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628533 | ZNF701 | zinc finger protein 701 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628591 | TMEM251 | transmembrane protein 251 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628818 | SLC25A34 | solute carrier family 25 member 34 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628896 | IGSF6 | immunoglobulin superfamily member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628958 | UBE2D4 | ubiquitin conjugating enzyme E2 D4 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT629005 | OSBPL10 | oxysterol binding protein like 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629059 | KIF1C | kinesin family member 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT629192 | PAPOLA | poly(A) polymerase alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT629346 | TMPRSS11BNL | TMPRSS11B N-terminal like, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT629447 | WIZ | widely interspaced zinc finger motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT629696 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629737 | SCD5 | stearoyl-CoA desaturase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629896 | SPATA5 | spermatogenesis associated 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629953 | GLP2R | glucagon like peptide 2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT630023 | MTL5 | testis expressed metallothionein like protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT630181 | TLN1 | talin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630325 | PAQR5 | progestin and adipoQ receptor family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630389 | MYH9 | myosin heavy chain 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT630695 | EXTL3 | exostosin like glycosyltransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631054 | LINC00346 | long intergenic non-protein coding RNA 346 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631130 | SYNJ2 | synaptojanin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631374 | COL4A3BP | collagen type IV alpha 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT631557 | TRAF3IP2 | TRAF3 interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631615 | PCDHB11 | protocadherin beta 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631935 | CDKAL1 | CDK5 regulatory subunit associated protein 1 like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT632109 | SSR1 | signal sequence receptor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632168 | CCL22 | C-C motif chemokine ligand 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632445 | SGTB | small glutamine rich tetratricopeptide repeat containing beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT632652 | NAV1 | neuron navigator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632688 | MTMR10 | myotubularin related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632828 | IGF1 | insulin like growth factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632905 | FRRS1 | ferric chelate reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633027 | DNAL1 | dynein axonemal light chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633379 | FBXW8 | F-box and WD repeat domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633440 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT633726 | BPNT1 | 3'(2'), 5'-bisphosphate nucleotidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633832 | WHAMM | WAS protein homolog associated with actin, golgi membranes and microtubules | ![]() |
![]() |
2 | 2 | ||||||
MIRT633862 | ATP6V1A | ATPase H+ transporting V1 subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT634042 | NUP155 | nucleoporin 155 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634266 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634374 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT634439 | PDE7A | phosphodiesterase 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT634573 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634620 | TOR1AIP2 | torsin 1A interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634693 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT634768 | CD3D | CD3d molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT635024 | WWTR1 | WW domain containing transcription regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635384 | NHLRC2 | NHL repeat containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635577 | TTC9C | tetratricopeptide repeat domain 9C | ![]() |
![]() |
2 | 2 | ||||||
MIRT635793 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635837 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636043 | ZSCAN29 | zinc finger and SCAN domain containing 29 | ![]() |
![]() |
2 | 4 | ||||||
MIRT636070 | ZNF280C | zinc finger protein 280C | ![]() |
![]() |
2 | 2 | ||||||
MIRT636697 | ARSK | arylsulfatase family member K | ![]() |
![]() |
2 | 2 | ||||||
MIRT637438 | ZNF324B | zinc finger protein 324B | ![]() |
![]() |
2 | 2 | ||||||
MIRT637582 | PLD6 | phospholipase D family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637672 | PPM1D | protein phosphatase, Mg2+/Mn2+ dependent 1D | ![]() |
![]() |
2 | 2 | ||||||
MIRT637887 | SLC19A3 | solute carrier family 19 member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT638353 | RBMS2 | RNA binding motif single stranded interacting protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT638597 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638821 | CRTAP | cartilage associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT638871 | CEP97 | centrosomal protein 97 | ![]() |
![]() |
2 | 4 | ||||||
MIRT639660 | PPEF2 | protein phosphatase with EF-hand domain 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT640200 | TIMM50 | translocase of inner mitochondrial membrane 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641592 | TNS4 | tensin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644993 | POLR2J3 | RNA polymerase II subunit J3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645059 | UQCRQ | ubiquinol-cytochrome c reductase complex III subunit VII | ![]() |
![]() |
2 | 2 | ||||||
MIRT646948 | UPK3BL | uroplakin 3B like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647306 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT648300 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | ![]() |
![]() |
2 | 4 | ||||||
MIRT649043 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649884 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT650196 | DOCK7 | dedicator of cytokinesis 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654789 | PRICKLE1 | prickle planar cell polarity protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655667 | NUP43 | nucleoporin 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655925 | NDUFA4P1 | NDUFA4, mitochondrial complex associated pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656433 | MARCH6 | membrane associated ring-CH-type finger 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657713 | GPC4 | glypican 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659302 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659844 | CAPZB | capping actin protein of muscle Z-line beta subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT660660 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661308 | CPM | carboxypeptidase M | ![]() |
![]() |
2 | 2 | ||||||
MIRT661473 | CHMP1B | charged multivesicular body protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT661906 | EBNA1BP2 | EBNA1 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662064 | ZNF284 | zinc finger protein 284 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662491 | ANGPT4 | angiopoietin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662657 | LRRC47 | leucine rich repeat containing 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662804 | MSRB2 | methionine sulfoxide reductase B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663164 | FGFR1OP | FGFR1 oncogene partner | ![]() |
![]() |
2 | 2 | ||||||
MIRT663376 | ZNF770 | zinc finger protein 770 | ![]() |
![]() |
2 | 4 | ||||||
MIRT663418 | ZNF607 | zinc finger protein 607 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663990 | WDR75 | WD repeat domain 75 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664157 | APOBEC3F | apolipoprotein B mRNA editing enzyme catalytic subunit 3F | ![]() |
![]() |
2 | 4 | ||||||
MIRT664489 | POLR3K | RNA polymerase III subunit K | ![]() |
![]() |
2 | 2 | ||||||
MIRT665058 | CCDC77 | coiled-coil domain containing 77 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665080 | CRIPT | CXXC repeat containing interactor of PDZ3 domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT665420 | WDR55 | WD repeat domain 55 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665716 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665923 | TBC1D19 | TBC1 domain family member 19 | ![]() |
![]() |
2 | 4 | ||||||
MIRT666239 | SLC38A7 | solute carrier family 38 member 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT666840 | PPTC7 | PTC7 protein phosphatase homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT667378 | MOB1B | MOB kinase activator 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT667573 | LONRF2 | LON peptidase N-terminal domain and ring finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667894 | ING1 | inhibitor of growth family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667977 | HECTD3 | HECT domain E3 ubiquitin protein ligase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668197 | GCNT4 | glucosaminyl (N-acetyl) transferase 4, core 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668279 | FOSL2 | FOS like 2, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT668386 | FAT3 | FAT atypical cadherin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668444 | FAM208A | family with sequence similarity 208 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT668998 | CHORDC1 | cysteine and histidine rich domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669180 | CCNF | cyclin F | ![]() |
![]() |
2 | 2 | ||||||
MIRT669444 | ATL3 | atlastin GTPase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669661 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669890 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT669973 | SSR3 | signal sequence receptor subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670153 | SLC29A4 | solute carrier family 29 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670240 | TRIM13 | tripartite motif containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670274 | CBY3 | chibby family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670358 | ULBP3 | UL16 binding protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670627 | BVES | blood vessel epicardial substance | ![]() |
![]() |
2 | 2 | ||||||
MIRT670731 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670770 | TRIM66 | tripartite motif containing 66 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670913 | DESI1 | desumoylating isopeptidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671216 | CLSTN1 | calsyntenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671398 | ERCC6L2 | ERCC excision repair 6 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671427 | TOX4 | TOX high mobility group box family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671654 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT671702 | PMPCA | peptidase, mitochondrial processing alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT672136 | PLEKHH1 | pleckstrin homology, MyTH4 and FERM domain containing H1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672395 | SLC10A6 | solute carrier family 10 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672508 | GGCX | gamma-glutamyl carboxylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT672572 | RNF24 | ring finger protein 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672789 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT673019 | RBBP4 | RB binding protein 4, chromatin remodeling factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT673190 | C10orf76 | chromosome 10 open reading frame 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673372 | ZNF124 | zinc finger protein 124 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673495 | MCF2L2 | MCF.2 cell line derived transforming sequence-like 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT673852 | CAPN7 | calpain 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673929 | ZNF500 | zinc finger protein 500 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673986 | MMAB | methylmalonic aciduria (cobalamin deficiency) cblB type | ![]() |
![]() |
2 | 2 | ||||||
MIRT674076 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674123 | RPL7L1 | ribosomal protein L7 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674297 | THAP5 | THAP domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674370 | POLR3D | RNA polymerase III subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT674641 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT674665 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674725 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 4 | ||||||
MIRT674779 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674889 | RASSF9 | Ras association domain family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675017 | SNX1 | sorting nexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675341 | KLHL26 | kelch like family member 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675416 | CLEC7A | C-type lectin domain containing 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT675497 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675615 | EHD2 | EH domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675735 | AHR | aryl hydrocarbon receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT675857 | ATP1B4 | ATPase Na+/K+ transporting family member beta 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675990 | CRKL | CRK like proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT676213 | TMEM91 | transmembrane protein 91 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676406 | MRO | maestro | ![]() |
![]() |
2 | 2 | ||||||
MIRT677299 | CPSF2 | cleavage and polyadenylation specific factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677387 | PCNP | PEST proteolytic signal containing nuclear protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT677859 | ABI2 | abl interactor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677965 | ITGB3 | integrin subunit beta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678175 | CRCP | CGRP receptor component | ![]() |
![]() |
2 | 2 | ||||||
MIRT678273 | PTRH2 | peptidyl-tRNA hydrolase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678665 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679003 | TTC39B | tetratricopeptide repeat domain 39B | ![]() |
![]() |
2 | 2 | ||||||
MIRT679053 | RMDN1 | regulator of microtubule dynamics 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679461 | RHOF | ras homolog family member F, filopodia associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT679513 | RAB36 | RAB36, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT679914 | ZKSCAN3 | zinc finger with KRAB and SCAN domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680029 | OSBPL2 | oxysterol binding protein like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT680245 | NDUFA7 | NADH:ubiquinone oxidoreductase subunit A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680279 | AKIP1 | A-kinase interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680499 | PRIM2 | DNA primase subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680586 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680629 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680819 | ARL8B | ADP ribosylation factor like GTPase 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT680998 | AAED1 | AhpC/TSA antioxidant enzyme domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681122 | INTS7 | integrator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681161 | IBA57 | IBA57 homolog, iron-sulfur cluster assembly | ![]() |
![]() |
2 | 2 | ||||||
MIRT681221 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681304 | IKZF3 | IKAROS family zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681341 | BRI3BP | BRI3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT681608 | F2RL2 | coagulation factor II thrombin receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681779 | EIF4A3 | eukaryotic translation initiation factor 4A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681892 | SLC11A2 | solute carrier family 11 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682084 | ITGA3 | integrin subunit alpha 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT682139 | SMS | spermine synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT682217 | SAR1A | secretion associated Ras related GTPase 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT682367 | PHACTR4 | phosphatase and actin regulator 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682535 | EXOSC2 | exosome component 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682618 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683643 | ZNF695 | zinc finger protein 695 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684008 | FOLR1 | folate receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684442 | MFSD4 | major facilitator superfamily domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT684855 | ZNF749 | zinc finger protein 749 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684956 | MINOS1 | mitochondrial inner membrane organizing system 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685044 | GEMIN4 | gem nuclear organelle associated protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685095 | DTD2 | D-tyrosyl-tRNA deacylase 2 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT685382 | TNFRSF13C | TNF receptor superfamily member 13C | ![]() |
![]() |
2 | 2 | ||||||
MIRT685456 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685810 | SLC27A1 | solute carrier family 27 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685913 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686665 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT686955 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687118 | QPCTL | glutaminyl-peptide cyclotransferase like | ![]() |
![]() |
2 | 2 | ||||||
MIRT687739 | KIAA1328 | KIAA1328 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688063 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT688191 | FNIP1 | folliculin interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688769 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688979 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689572 | NUDT7 | nudix hydrolase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689683 | TMPRSS12 | transmembrane protease, serine 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689930 | MANSC1 | MANSC domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690089 | PNMA2 | paraneoplastic Ma antigen 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690190 | C5orf45 | MRN complex interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT690246 | CAMLG | calcium modulating ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT690411 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690840 | DSN1 | DSN1 homolog, MIS12 kinetochore complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT690889 | FUT2 | fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691107 | ADIPOQ | adiponectin, C1Q and collagen domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT691229 | DFNB59 | pejvakin | ![]() |
![]() |
2 | 2 | ||||||
MIRT691300 | ZNF681 | zinc finger protein 681 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691366 | GP5 | glycoprotein V platelet | ![]() |
![]() |
2 | 2 | ||||||
MIRT691797 | WARS | tryptophanyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT692142 | CEP104 | centrosomal protein 104 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692572 | NCMAP | non-compact myelin associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT692649 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692744 | NDUFS5 | NADH:ubiquinone oxidoreductase subunit S5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693092 | SCNM1 | sodium channel modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693296 | SYTL3 | synaptotagmin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693392 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693530 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693562 | PIGR | polymeric immunoglobulin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT694492 | AGBL5 | ATP/GTP binding protein like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694722 | LLGL1 | LLGL1, scribble cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT694866 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695070 | ZNF17 | zinc finger protein 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695451 | COX18 | COX18, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT695724 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695898 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696244 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696259 | TACO1 | translational activator of cytochrome c oxidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT696512 | C3 | complement C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696560 | TTC21B | tetratricopeptide repeat domain 21B | ![]() |
![]() |
2 | 2 | ||||||
MIRT696643 | AGXT2 | alanine--glyoxylate aminotransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696791 | DHODH | dihydroorotate dehydrogenase (quinone) | ![]() |
![]() |
2 | 2 | ||||||
MIRT696819 | PLLP | plasmolipin | ![]() |
![]() |
2 | 2 | ||||||
MIRT697088 | GPKOW | G-patch domain and KOW motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT697153 | INMT | indolethylamine N-methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT697202 | ZYG11A | zyg-11 family member A, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT697322 | ZNF641 | zinc finger protein 641 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697578 | YME1L1 | YME1 like 1 ATPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT697619 | WSB1 | WD repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698619 | TES | testin LIM domain protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT698804 | STK38 | serine/threonine kinase 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698949 | SPAST | spastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT699083 | SNRPD3 | small nuclear ribonucleoprotein D3 polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT699430 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699550 | SIT1 | signaling threshold regulating transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700324 | RAB4A | RAB4A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT700360 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT700462 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT701677 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 2 | ||||||
MIRT701757 | MSL2 | MSL complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701977 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703178 | GPBP1 | GC-rich promoter binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703203 | GOLGA3 | golgin A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703359 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703425 | FYTTD1 | forty-two-three domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703484 | FNDC3B | fibronectin type III domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT703590 | FBXO45 | F-box protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703806 | EVI5 | ecotropic viral integration site 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703915 | EPG5 | ectopic P-granules autophagy protein 5 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704234 | DHDDS | dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT704646 | CLCC1 | chloride channel CLIC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705151 | C11orf58 | chromosome 11 open reading frame 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705480 | ASXL2 | additional sex combs like 2, transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT705530 | ARL10 | ADP ribosylation factor like GTPase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705661 | ANKRD40 | ankyrin repeat domain 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706144 | ZNF674 | zinc finger protein 674 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706473 | SNX27 | sorting nexin family member 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708254 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT708838 | SCAND3 | zinc finger BED-type containing 9 | ![]() |
1 | 1 | |||||||
MIRT710437 | BTNL3 | butyrophilin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711325 | DPYSL5 | dihydropyrimidinase like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716151 | RBM48 | RNA binding motif protein 48 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717402 | ZCCHC24 | zinc finger CCHC-type containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720866 | ADCY5 | adenylate cyclase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722226 | ZNF503 | zinc finger protein 503 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|