| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-497 |
| Genomic Coordinates | chr17: 7017911 - 7018022 |
| Synonyms | MIRN497, hsa-mir-497, MIR497 |
| Description | Homo sapiens miR-497 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-497-3p | ||||||||||||||||||||||||||||
| Sequence | 64| CAAACCACACUGUGGUGUUAGA |85 | ||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||
| Experiments | Cloned | ||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | ANKEF1 | ||||||||||||||||||||
| Synonyms | ANKRD5 | ||||||||||||||||||||
| Description | ankyrin repeat and EF-hand domain containing 1 | ||||||||||||||||||||
| Transcript | NM_022096 | ||||||||||||||||||||
| Other Transcripts | NM_198798 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on ANKEF1 | |||||||||||||||||||||
| 3'UTR of ANKEF1 (miRNA target sites are highlighted) |
>ANKEF1|NM_022096|3'UTR 1 GTCATAGCAGTTATTTCTTGGGGTAAATGCTTTGAGGCCCAGGGACCAATCTTTGGAGAAAGTAGATATTTCCATCAAAG 81 CCAAAGCAATCCATACACCAAGAACTTGTTACCAAGAATTTCTTTTTGCTTTAACAACTATAAATATTCTTAGCTGTCTA 161 GAGAAAAGATGTATGTTATTTTGAAATGAATGGTATGTCATTCTGGATAAATCCCCAAGCCCCTTTATGAATGTAGTGAA 241 ATACATGGCATGTGGGTTATAAACGTTGCTGTCAAAAGATTTACCAGGTCTACACCATTATGCTTATTATTTTTTTAATT 321 ATCCTTTTTATTTATTAAATAGAGACAGAGTCTCACTATATTGCCCCAGCTGGTCTCGAACTCTTGAGCTCAGGCAGTCC 401 TCCCAACTTGGCCGTCGAAAGTGCTGGGATTATAGGCATGAGCTACTGTGCCCAGCCTGCTTATTGAAGATACATTTCTA 481 GTGGAAATTGATGAAACAATTTAGGTTTTGGAAAAAGAAGTAATATTTAATCTTTTAAGGAAGGAGTTTATTTCTCACAT 561 GCCATTATAAACTATGTGTATTAGATACCTTGGGTTGAATACACTTTTAACAGCCCTAGATCGATAGCCCTAGCCCTAGA 641 TAGATAGCCCTAGCCCTAGATAGATAGCTATTAGGTTGGTGCAAAAGTAATTGTGGTTTTTGCCATAACCTTTAATTGCA 721 GCAAAAACCGCAATTACTTTTGCTCCAACCTGACAGCTAGGTATCTAGCTAGCTAGAAAGGCAGATAGACAGATATATAG 801 ATGATAGATAGATAGATGATAGATAGATAGATAGATGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAGA 881 TTTATTGCAAATAATTGGTTTACATAATTTTGGGCCCCAGATGGTTAAGTGCTAAATTTGTAGGGTAGGCTATCAGGAAG 961 TGCAGGCTGGAAACATGCAGGAGCTGTCCCTGAAGTCCACAAGTGGAATTTCTTCTTCATCATGGAAACCTCAGTTTTGT 1041 TCATACACCTAAATACTTCAGTATGTCTTTCCTAAAATAAAAGGCATCCATTTACCTAACCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 63926.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 63926.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Hela |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
| Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 63926.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293/HeLa |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells)
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
| Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
| Experimental Support 8 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 9 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760620. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_A
PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000378380.3 | 3UTR | UUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1048187 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
| Location of target site | ENST00000378380.3 | 3UTR | GUGCAAAAGUAAUUGUGGUUUUUGCCAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23313552 / GSE42701 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1048188 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
| Location of target site | ENST00000378380.3 | 3UTR | GUGCAAAAGUAAUUGUGGUUUUUGCCAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23313552 / GSE42701 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1067869 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (asynchronous cells) |
| Location of target site | ENST00000378380.3 | 3UTR | AGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1067870 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
| Location of target site | ENST00000378380.3 | 3UTR | AUUAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000378380.3 | 3UTR | AAAAGUAAUUGUGGUUUUUGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000378380.3 | 3UTR | AAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000378380.3 | 3UTR | CAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000378380.3 | 3UTR | AAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000378380.3 | 3UTR | CAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000378380.3 | 3UTR | AAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000378380.3 | 3UTR | AGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000378380.3 | 3UTR | CAAAAGUAAUUGUGGUUUUUGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000378380.3 | 3UTR | UAGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 15 for dataset GSM714647 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repB |
| Location of target site | ENST00000378380.3 | 3UTR | GUUGGUGCAAAAGUAAUUGUGGUUUUUGCCAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 16 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000378380.3 | 3UTR | CAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 17 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000378380.3 | 3UTR | AGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 18 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000378380.3 | 3UTR | AGGUUGGUGCAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 19 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000378380.3 | 3UTR | CAAAAGUAAUUGUGGUUUUUGCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 20 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000378380.3 | 3UTR | AAAAGUAAUUGUGGUUUUUGCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT092955 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 |  |
|
2 | 4 | ||||||
| MIRT124568 | PRRC2B | proline rich coiled-coil 2B | |
|
2 | 2 | ||||||
| MIRT125196 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | |
|
2 | 4 | ||||||
| MIRT147296 | KPNA2 | karyopherin subunit alpha 2 | |
|
2 | 8 | ||||||
| MIRT163999 | KIAA1109 | KIAA1109 | |
|
2 | 4 | ||||||
| MIRT252495 | NWD1 | NACHT and WD repeat domain containing 1 | |
|
2 | 2 | ||||||
| MIRT357969 | GRPEL2 | GrpE like 2, mitochondrial | |
|
2 | 2 | ||||||
| MIRT443007 | TRIOBP | TRIO and F-actin binding protein | |
|
2 | 2 | ||||||
| MIRT443524 | NETO1 | neuropilin and tolloid like 1 | |
|
2 | 2 | ||||||
| MIRT443573 | EVX2 | even-skipped homeobox 2 | |
|
2 | 2 | ||||||
| MIRT443656 | BACH1 | BTB domain and CNC homolog 1 | |
|
2 | 2 | ||||||
| MIRT460670 | KRT10 | keratin 10 | |
|
2 | 8 | ||||||
| MIRT464761 | UBE2N | ubiquitin conjugating enzyme E2 N | |
|
2 | 2 | ||||||
| MIRT465032 | LINC00598 | long intergenic non-protein coding RNA 598 | |
|
2 | 2 | ||||||
| MIRT465040 | TTC39C | tetratricopeptide repeat domain 39C | |
|
2 | 2 | ||||||
| MIRT468667 | SEC62 | SEC62 homolog, preprotein translocation factor | |
|
2 | 2 | ||||||
| MIRT473694 | MAPK8 | mitogen-activated protein kinase 8 | |
|
2 | 4 | ||||||
| MIRT477618 | EFNA3 | ephrin A3 | |
|
2 | 2 | ||||||
| MIRT480506 | C11orf57 | chromosome 11 open reading frame 57 | |
|
2 | 2 | ||||||
| MIRT480592 | BUB3 | BUB3, mitotic checkpoint protein | |
|
2 | 2 | ||||||
| MIRT486915 | ZNF398 | zinc finger protein 398 | |
|
2 | 6 | ||||||
| MIRT487770 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | |
|
2 | 16 | ||||||
| MIRT493265 | MDFIC | MyoD family inhibitor domain containing | |
|
2 | 2 | ||||||
| MIRT495271 | SLC1A2 | solute carrier family 1 member 2 | |
|
2 | 4 | ||||||
| MIRT495309 | CHST12 | carbohydrate sulfotransferase 12 | |
|
2 | 2 | ||||||
| MIRT496681 | DPP6 | dipeptidyl peptidase like 6 | |
|
2 | 4 | ||||||
| MIRT496891 | FOXP1 | forkhead box P1 | |
|
2 | 2 | ||||||
| MIRT497330 | IRF4 | interferon regulatory factor 4 | |
|
2 | 2 | ||||||
| MIRT498272 | KIAA1644 | KIAA1644 | |
|
2 | 2 | ||||||
| MIRT498634 | CHD4 | chromodomain helicase DNA binding protein 4 | |
|
2 | 10 | ||||||
| MIRT500581 | USP53 | ubiquitin specific peptidase 53 | |
|
2 | 2 | ||||||
| MIRT500751 | TMPPE | transmembrane protein with metallophosphoesterase domain | |
|
2 | 6 | ||||||
| MIRT509668 | ZNF354B | zinc finger protein 354B | |
|
2 | 10 | ||||||
| MIRT510919 | PSMA2 | proteasome subunit alpha 2 | |
|
2 | 4 | ||||||
| MIRT519118 | CEP76 | centrosomal protein 76 | |
|
2 | 2 | ||||||
| MIRT526193 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | |
|
2 | 2 | ||||||
| MIRT526746 | HLA-DOB | major histocompatibility complex, class II, DO beta | |
|
2 | 2 | ||||||
| MIRT527270 | FBLN2 | fibulin 2 | |
|
2 | 2 | ||||||
| MIRT528198 | PLEKHM2 | pleckstrin homology and RUN domain containing M2 | |
|
2 | 2 | ||||||
| MIRT528330 | TBC1D22B | TBC1 domain family member 22B | |
|
2 | 2 | ||||||
| MIRT530346 | GABRB3 | gamma-aminobutyric acid type A receptor beta3 subunit | |
|
2 | 2 | ||||||
| MIRT533627 | TMX3 | thioredoxin related transmembrane protein 3 | |
|
2 | 2 | ||||||
| MIRT533738 | TMEM200C | transmembrane protein 200C | |
|
2 | 2 | ||||||
| MIRT533779 | TMEM133 | transmembrane protein 133 | |
|
2 | 2 | ||||||
| MIRT534317 | SKIDA1 | SKI/DACH domain containing 1 | |
|
2 | 2 | ||||||
| MIRT538438 | COG5 | component of oligomeric golgi complex 5 | |
|
2 | 2 | ||||||
| MIRT539156 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT539474 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | |
|
2 | 2 | ||||||
| MIRT539620 | SHISA9 | shisa family member 9 | |
|
2 | 2 | ||||||
| MIRT539650 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | |
|
2 | 2 | ||||||
| MIRT540346 | OPHN1 | oligophrenin 1 | |
|
2 | 2 | ||||||
| MIRT540412 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | |
|
2 | 2 | ||||||
| MIRT541200 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | |
|
2 | 2 | ||||||
| MIRT541395 | CDC27 | cell division cycle 27 | |
|
2 | 2 | ||||||
| MIRT546443 | SNX5 | sorting nexin 5 | |
|
2 | 2 | ||||||
| MIRT547369 | MSI2 | musashi RNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT553288 | TSPAN3 | tetraspanin 3 | |
|
2 | 2 | ||||||
| MIRT554402 | SERP1 | stress associated endoplasmic reticulum protein 1 | |
|
2 | 2 | ||||||
| MIRT557822 | FOXN2 | forkhead box N2 | |
|
2 | 2 | ||||||
| MIRT568530 | ANP32E | acidic nuclear phosphoprotein 32 family member E | |
|
2 | 2 | ||||||
| MIRT569508 | THYN1 | thymocyte nuclear protein 1 | |
|
2 | 2 | ||||||
| MIRT570707 | FAM69A | family with sequence similarity 69 member A | |
|
2 | 2 | ||||||
| MIRT608376 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | |
|
2 | 2 | ||||||
| MIRT608483 | NKTR | natural killer cell triggering receptor | |
|
2 | 6 | ||||||
| MIRT613533 | TRA2B | transformer 2 beta homolog | |
|
2 | 2 | ||||||
| MIRT616601 | ELP2 | elongator acetyltransferase complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT618166 | DUSP18 | dual specificity phosphatase 18 | |
|
2 | 2 | ||||||
| MIRT632059 | CEP135 | centrosomal protein 135 | |
|
2 | 2 | ||||||
| MIRT647379 | ZDHHC23 | zinc finger DHHC-type containing 23 | |
|
2 | 2 | ||||||
| MIRT648366 | POTED | POTE ankyrin domain family member D | |
|
2 | 2 | ||||||
| MIRT651075 | ZNF518B | zinc finger protein 518B | |
|
2 | 4 | ||||||
| MIRT653618 | SLC30A4 | solute carrier family 30 member 4 | |
|
2 | 2 | ||||||
| MIRT653636 | SLC30A1 | solute carrier family 30 member 1 | |
|
2 | 2 | ||||||
| MIRT654895 | POU2F1 | POU class 2 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT656232 | MFSD6 | major facilitator superfamily domain containing 6 | |
|
2 | 2 | ||||||
| MIRT659880 | CAPRIN1 | cell cycle associated protein 1 | |
|
2 | 2 | ||||||
| MIRT660526 | ARL4C | ADP ribosylation factor like GTPase 4C | |
|
2 | 2 | ||||||
| MIRT666286 | SLC30A3 | solute carrier family 30 member 3 | |
|
2 | 2 | ||||||
| MIRT686808 | SNX2 | sorting nexin 2 | |
|
2 | 4 | ||||||
| MIRT695302 | TK1 | thymidine kinase 1 | |
|
2 | 2 | ||||||
| MIRT699737 | SERINC3 | serine incorporator 3 | |
|
2 | 2 | ||||||
| MIRT700794 | PIAS2 | protein inhibitor of activated STAT 2 | |
|
2 | 2 | ||||||
| MIRT712270 | PPP1CB | protein phosphatase 1 catalytic subunit beta | |
|
2 | 2 | ||||||
| MIRT712617 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | |
|
2 | 2 | ||||||
| MIRT714264 | RPL10A | ribosomal protein L10a | |
|
2 | 2 | ||||||
| MIRT715072 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | |
|
2 | 2 | ||||||
| MIRT715386 | TADA3 | transcriptional adaptor 3 | |
|
2 | 2 | ||||||
| MIRT716397 | NPAS1 | neuronal PAS domain protein 1 | |
|
2 | 2 | ||||||
| MIRT725328 | NFASC | neurofascin | |
|
2 | 2 | ||||||
| MIRT725503 | GANAB | glucosidase II alpha subunit | |
|
2 | 2 | ||||||
| MIRT732913 | IRAK2 | interleukin 1 receptor associated kinase 2 | |
|
|
3 | 0 | |||||
| MIRT734890 | SMAD3 | SMAD family member 3 | |
|
|
3 | 0 | |||||
| MIRT737328 | LINC02476 | long intergenic non-protein coding RNA 2476 | |
|
|
3 | 0 | |||||
| MIRT737544 | MALAT1 | metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) | |
|
|
|
4 | 0 | ||||
| MIRT755545 | PAK1 | p21 (RAC1) activated kinase 1 | 3 | 1 | ||||||||
| miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|