>FXYD1|NM_005031|3'UTR
   1 AAACACCTGGAGCGATGGAATCCGGCCAGGACTCCCCTGGCACCTGACATCTCCCACGCTCCACCTGCGCGCCCACCGCC
  81 CCCTCCGCCGCCCCTTCCCCAGCCCTGCCCCCGCAGACTCCCCCTGCCGCCAAGACTTCCAATAAAACGTGCGTTCCTCT
 161 CGACAGCAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gauucUGGUUCGGAGGAAGGGa 5' :|| ||| ||||||| Target 5' cctccGCC--GCC-CCTTCCCc 3'	82 - 100	148.00	-19.60
2	miRNA 3' gauucUGGUUCGGAGGAAGGga 5' :||||| ||||| Target 5' ctgccGCCAAGA---CTTCCaa 3'	124 - 142	105.00	-14.90
3	miRNA 3' gauuCUGGUUCGGAGGAAGGGa 5' |:|||:| || ||| Target 5' atccGGCCAGGA---CTCCCCt 3'	20 - 38	94.00	-16.50

Mutant ID	Mutant Position	Mutant Source
COSN30116559	8	COSMIC
COSN30450099	10	COSMIC
COSN508346	20	COSMIC
COSN30134065	30	COSMIC
COSN8605627	46	COSMIC
COSN28451054	133	COSMIC
COSN17468257	271	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs535283242	2	dbSNP
rs1135396	5	dbSNP
rs377667040	8	dbSNP
rs369430419	9	dbSNP
rs1004874934	12	dbSNP
rs1358447848	24	dbSNP
rs1260892418	25	dbSNP
rs754736922	26	dbSNP
rs1304034695	27	dbSNP
rs1379219720	35	dbSNP
rs1445461439	39	dbSNP
rs1306609934	41	dbSNP
rs536603524	44	dbSNP
rs776905341	48	dbSNP
rs765705537	50	dbSNP
rs572001504	61	dbSNP
rs540738270	65	dbSNP
rs1264415718	71	dbSNP
rs1218752535	74	dbSNP
rs962637716	89	dbSNP
rs1199180286	92	dbSNP
rs974371195	98	dbSNP
rs1245892227	105	dbSNP
rs1476934173	106	dbSNP
rs563707390	110	dbSNP
rs921117360	111	dbSNP
rs1424257453	112	dbSNP
rs953975450	113	dbSNP
rs1002736826	116	dbSNP
rs377132171	125	dbSNP
rs1292956024	126	dbSNP
rs1052930248	128	dbSNP
rs938499533	129	dbSNP
rs577243868	130	dbSNP
rs543039998	144	dbSNP
rs1464886631	149	dbSNP
rs1371182922	151	dbSNP
rs1172437894	156	dbSNP
rs1009653336	162	dbSNP
rs934355177	172	dbSNP
rs1022339971	177	dbSNP
rs878988440	179	dbSNP
rs549307609	184	dbSNP
rs1188902923	191	dbSNP
rs1469445444	194	dbSNP
rs968063094	203	dbSNP
rs1329662124	204	dbSNP
rs1433365343	205	dbSNP
rs1052699628	207	dbSNP
rs1017874061	210	dbSNP
rs966665941	212	dbSNP
rs1057455	214	dbSNP
rs1056528962	221	dbSNP
rs1301223235	223	dbSNP
rs914213135	224	dbSNP
rs1373348176	225	dbSNP
rs1326810620	227	dbSNP
rs947652688	233	dbSNP
rs919386077	236	dbSNP
rs1169375633	237	dbSNP
rs1376961608	247	dbSNP
rs1336375349	248	dbSNP
rs1171735415	251	dbSNP
rs1045007892	254	dbSNP
rs1455177496	257	dbSNP
rs1395224241	258	dbSNP
rs1177621424	261	dbSNP
rs1456126021	263	dbSNP
rs906034229	266	dbSNP
rs1252256614	273	dbSNP
rs950508192	275	dbSNP
rs984494727	276	dbSNP
rs908908856	279	dbSNP
rs1232812794	294	dbSNP
rs1350135951	300	dbSNP
rs938845480	305	dbSNP
rs1057247677	314	dbSNP
rs1334159123	315	dbSNP
rs1449593701	322	dbSNP
rs948433550	328	dbSNP
rs1044425814	337	dbSNP
rs1310981107	338	dbSNP
rs201592085	344	dbSNP
rs70950369	344	dbSNP
rs62111365	345	dbSNP
rs59264982	346	dbSNP
rs1468183211	351	dbSNP
rs1365150030	353	dbSNP
rs111623595	363	dbSNP
rs1420035510	366	dbSNP
rs928578914	367	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.