| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-520a |
| Genomic Coordinates | chr19: 53690881 - 53690965 |
| Description | Homo sapiens miR-520a stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-520a-5p | ||||||||||||||||||||||||
| Sequence | 15| CUCCAGAGGGAAGUACUUUCU |35 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Array-cloned | ||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | TSTD2 | ||||||||||||||||||||
| Synonyms | C9orf97 | ||||||||||||||||||||
| Description | thiosulfate sulfurtransferase like domain containing 2 | ||||||||||||||||||||
| Transcript | NM_139246 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on TSTD2 | |||||||||||||||||||||
| 3'UTR of TSTD2 (miRNA target sites are highlighted) |
>TSTD2|NM_139246|3'UTR 1 GCAGCACCTTTGGCATTTTCCCAGGCCCTCGGTAAAAGTAGGTTTGGGGTGACTATACAGAGAAAGCATGGCAAGACTGC 81 AGAAACAGAGAAATCGGGAACTTCAGTTCTGGCCGCTGCCACCGTGGCAGCCGTCTACACTTCACAGCGGGAGGGGAGGA 161 GTCACGTTGTCTACCACTTACCTGAGACATTCTGATTTGGATGATGCTAGAGCACAGAAAATAGGTGAGCTGCATGGGAT 241 CCCAAAGCTGCTGAGGGATAGAGCCTGAGCCTGGTGGCCACAGCATATGCCCTTTCTGTTCCATGCAGCTGGGGCTGTTA 321 GTAGTCATTGCCCTTGTCAGCAGACCTTCTACCCTGGTGGCAAACACATGAAAGCTGTGGCCCTGGGAGTGGCCTCCTAA 401 AACAAGCCACTTAGGTCATCTGCCATCTACCCTTAACCTCTGTCTCTCGCCTGAGGGGAATCTGCAAGCTGTGCATTGGG 481 CTTACCTCCTGCTTTTGTAGAAATAACCATCCTTTGGTATACATGGAGGATAGTTCCAGAACGCCTGAGTATACAAAAAC 561 CCAATGCATACTCAAGTCCCACAGTGGGCCCTACAGAACCCACGTATGTGATAAATCAGCCCTCCATGTACGCAGGTTTC 641 GCCCCCTGCCAATACTGTATTTTCAACCTGTATGGTTGAAAAAAATCCATATATAAGTGCAGCCATGCAGTTCAAACCCA 721 TATTGTTCAAGGGTCAACTGTATAGTTTATTGAACAGCCACACCCATTCCTTTACACATGATCTATGGCAGAGTTGAATA 801 GTTGCAACAGACACTATGTGGCCTGCAAAATCGGAAATTTTTACTGTCTGGCCTTTTACAGAAAAGTTTGCCAGCCCCTG 881 ATCTAGACCAGCAGCTCATCTGATAGAGGCAGAGGTGGCCTTAAAGATGTGGCCTTCTTCATTTTCTGTTGGTTTGGTTT 961 CGTTTCTATGAGAGATTTCCTCTGATAGCTCTGCTTTCCCCAGCACTTACTCTCTGAGCTTTTAAATGTTCTCTCTGGGA 1041 GCTTCATATAAGCTCGGTGACATTTGAGCCACAGTTTTTAGATCAGCACCTGGAATACATGACACATTCTTACTGAGGTC 1121 ATCCAGCACTGCCATGGTGGCTGCCCAGTCTTCTGGCCAGTGTGCCAGGCACATGTCCCTGTCACACAGGTTCCAAGAAA 1201 CACATACGCAGCCATGCATAGACCAACAGATTTAATATTATATTGCAGTTTTCAGCGATGCAGAATGCAGCTGCAATTGT 1281 GTTTTAAGGAGAAGCCAAATGGGGATGGTTGTCCCTGCAACATGGTGCCACTCCTGGGCCATGTGCAGCCTCAGTGGACA 1361 CTCTTCCATAGCGCTGAGGCCCTGGCCCCGCCTCCAGTTACCCTGTACTGCCCACTGCCTTACAGTTCAGTGCGCAGGCC 1441 TTCACCTTTTCATCACCAGCCTCTCTGCTCAGTGCTCTGGAGTTCTTGACCTTGTCCTTTATCATGAGATTTGCTGAAAT 1521 CACTAATGAAAATAACTCCCAAAAGCAACAAACAAAAATATTAGTTTAACTGGCACTGTGGTATATTAAAAGGCACAAGG 1601 GCATTGTGGCTTAACACTTTTGCTGGATCCCAAGAGACGCACATGATGTTAAAAAGAGATCTGGCAGCAGTACTAATACT 1681 ACATTTCAGTGTAATCATCTTGGGGTGGTTTGGCCAGGATTTCCCAATTCCTTGATATCTGGAGTTTCTTCACCATTGTC 1761 CGGCATCCTGCGGAGGCTTAATATACAGGCGTAAGGTCAGCAGCAATTTGTCTAATAAGTGATGAGATCAGTAGCTGAAG 1841 TCTCTAAGCTGGGCCATTACTAAATACCATAGCCATGTTGATCTGGAAATTTATCCCTCTAGTGTCTTACCTCACATAAG 1921 CCATTTGCCCACTGTGCAATATAGAAAGGTGTTTTCAAAAGTATTTGGCCGTAGATTTTCACATCCATCATAAGGTTGGC 2001 ATTCAATAAGGAAAAAGTTCTAACTCCAGTATTAAATTGTACATAAATCCCAAATGTTCTTAAAGAACACTCAGGGACAT 2081 GTTTGTTGCCTGGGATTGGTAATGAAAGGTTGGTTTTTGAAACTTGAAATTTCACCATTGGTTTTTTTCCTATCATTTCT 2161 GCATATCCAGCAAAAGGAATCTCATGTTGACTCCTGGCAGAGTTCAGTGGCTTCAGTCTGTCTATCTGTTCTGAGGGGAA 2241 AATTGTGTTCTGGATCCAGTAATCAATTTGGCAACTTTAATCGAGGTTTTCAAAATTCCAAGGAGGGTTAATAAAGAATG 2321 ATAATCAGTTTTATTTGCTAATAGCTAAGACAAATTTGTAATAAAGTGTTTTATAATACTTCAAAAGCAAAAAAAAAAAA 2401 AAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 158427.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000341170.4 | 3UTR | UCUCUGCUCAGUGCUCUGGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000341170.4 | 3UTR | UCUCUGCUCAGUGCUCUGGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000341170.4 | 3UTR | CUCUCUGCUCAGUGCUCUGGAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000341170.4 | 3UTR | UCAUCACCAGCCUCUCUGCUCAGUGCUCUGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
115 hsa-miR-520a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT092732 | SETD5 | SET domain containing 5 |  |
|
2 | 4 | ||||||
| MIRT168595 | HMGA1 | high mobility group AT-hook 1 | |
|
2 | 4 | ||||||
| MIRT232084 | CCSAP | centriole, cilia and spindle associated protein | |
|
2 | 2 | ||||||
| MIRT252430 | MIDN | midnolin | |
|
2 | 4 | ||||||
| MIRT294600 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT343114 | IGF1R | insulin like growth factor 1 receptor | |
|
2 | 2 | ||||||
| MIRT441904 | SEPN1 | selenoprotein N | |
|
2 | 2 | ||||||
| MIRT443233 | ALG8 | ALG8, alpha-1,3-glucosyltransferase | |
|
2 | 2 | ||||||
| MIRT446250 | ELP2 | elongator acetyltransferase complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT448001 | GPR63 | G protein-coupled receptor 63 | |
|
2 | 2 | ||||||
| MIRT451560 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | |
|
2 | 2 | ||||||
| MIRT455285 | BCL2L1 | BCL2 like 1 | |
|
2 | 2 | ||||||
| MIRT456170 | ZDHHC6 | zinc finger DHHC-type containing 6 | |
|
2 | 2 | ||||||
| MIRT456679 | LDB1 | LIM domain binding 1 | |
|
2 | 2 | ||||||
| MIRT458206 | FOXL2 | forkhead box L2 | |
|
2 | 2 | ||||||
| MIRT461267 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT461683 | ZNF426 | zinc finger protein 426 | |
|
2 | 2 | ||||||
| MIRT462656 | HMOX1 | heme oxygenase 1 | |
|
2 | 4 | ||||||
| MIRT464368 | URM1 | ubiquitin related modifier 1 | |
|
2 | 2 | ||||||
| MIRT468138 | SH3BP4 | SH3 domain binding protein 4 | |
|
2 | 2 | ||||||
| MIRT468234 | SGK1 | serum/glucocorticoid regulated kinase 1 | |
|
2 | 2 | ||||||
| MIRT470357 | PPP2R5E | protein phosphatase 2 regulatory subunit B'epsilon | |
|
2 | 2 | ||||||
| MIRT472039 | NPAT | nuclear protein, coactivator of histone transcription | |
|
2 | 2 | ||||||
| MIRT475941 | GXYLT1 | glucoside xylosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT477880 | DYNLL2 | dynein light chain LC8-type 2 | |
|
2 | 2 | ||||||
| MIRT480419 | C17orf85 | nuclear cap binding subunit 3 | |
|
2 | 2 | ||||||
| MIRT482642 | RPL18A | ribosomal protein L18a | |
|
2 | 2 | ||||||
| MIRT485666 | CDC25B | cell division cycle 25B | |
|
2 | 2 | ||||||
| MIRT485740 | CALCR | calcitonin receptor | |
|
2 | 2 | ||||||
| MIRT488906 | TSTD2 | thiosulfate sulfurtransferase like domain containing 2 | |
|
2 | 6 | ||||||
| MIRT490412 | NRXN3 | neurexin 3 | |
|
2 | 2 | ||||||
| MIRT494726 | ARHGAP1 | Rho GTPase activating protein 1 | |
|
2 | 6 | ||||||
| MIRT495957 | TBC1D19 | TBC1 domain family member 19 | |
|
2 | 2 | ||||||
| MIRT498087 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | |
|
2 | 2 | ||||||
| MIRT507449 | EIF6 | eukaryotic translation initiation factor 6 | |
|
2 | 2 | ||||||
| MIRT522992 | INPP4A | inositol polyphosphate-4-phosphatase type I A | |
|
2 | 4 | ||||||
| MIRT526008 | RBM4B | RNA binding motif protein 4B | |
|
2 | 2 | ||||||
| MIRT527693 | IL17REL | interleukin 17 receptor E like | |
|
2 | 2 | ||||||
| MIRT528202 | NELFE | negative elongation factor complex member E | |
|
2 | 2 | ||||||
| MIRT529123 | HOMEZ | homeobox and leucine zipper encoding | |
|
2 | 2 | ||||||
| MIRT529484 | TPD52L3 | tumor protein D52 like 3 | |
|
2 | 2 | ||||||
| MIRT530760 | ZNF582 | zinc finger protein 582 | |
|
2 | 2 | ||||||
| MIRT531930 | IL12RB2 | interleukin 12 receptor subunit beta 2 | |
|
2 | 2 | ||||||
| MIRT532347 | PLEK | pleckstrin | |
|
2 | 2 | ||||||
| MIRT532819 | ZNF827 | zinc finger protein 827 | |
|
2 | 2 | ||||||
| MIRT533262 | VAV3 | vav guanine nucleotide exchange factor 3 | |
|
2 | 4 | ||||||
| MIRT533518 | TRIM13 | tripartite motif containing 13 | |
|
2 | 2 | ||||||
| MIRT534279 | SLC12A7 | solute carrier family 12 member 7 | |
|
2 | 2 | ||||||
| MIRT534483 | SAR1B | secretion associated Ras related GTPase 1B | |
|
2 | 2 | ||||||
| MIRT538555 | CELF1 | CUGBP Elav-like family member 1 | |
|
2 | 4 | ||||||
| MIRT538801 | C2CD5 | C2 calcium dependent domain containing 5 | |
|
2 | 2 | ||||||
| MIRT553759 | TAOK1 | TAO kinase 1 | |
|
2 | 2 | ||||||
| MIRT556035 | MXD1 | MAX dimerization protein 1 | |
|
2 | 2 | ||||||
| MIRT557541 | GOSR1 | golgi SNAP receptor complex member 1 | |
|
2 | 2 | ||||||
| MIRT562451 | CSDE1 | cold shock domain containing E1 | |
|
2 | 2 | ||||||
| MIRT563686 | RPS26 | ribosomal protein S26 | |
|
2 | 2 | ||||||
| MIRT568249 | BTF3L4 | basic transcription factor 3 like 4 | |
|
2 | 2 | ||||||
| MIRT568422 | ATF7IP | activating transcription factor 7 interacting protein | |
|
2 | 2 | ||||||
| MIRT574053 | PROSC | pyridoxal phosphate binding protein | |
|
2 | 2 | ||||||
| MIRT606825 | APBB2 | amyloid beta precursor protein binding family B member 2 | |
|
2 | 2 | ||||||
| MIRT609585 | GPM6B | glycoprotein M6B | |
|
2 | 2 | ||||||
| MIRT609680 | TMEM213 | transmembrane protein 213 | |
|
2 | 2 | ||||||
| MIRT611223 | ZNF274 | zinc finger protein 274 | |
|
2 | 2 | ||||||
| MIRT612585 | SYNGAP1 | synaptic Ras GTPase activating protein 1 | |
|
2 | 4 | ||||||
| MIRT613585 | MDGA2 | MAM domain containing glycosylphosphatidylinositol anchor 2 | |
|
2 | 2 | ||||||
| MIRT614396 | C11orf45 | chromosome 11 open reading frame 45 | |
|
2 | 2 | ||||||
| MIRT615562 | JPH2 | junctophilin 2 | |
|
2 | 2 | ||||||
| MIRT615852 | RASGRP1 | RAS guanyl releasing protein 1 | |
|
2 | 2 | ||||||
| MIRT615934 | MAP1LC3B | microtubule associated protein 1 light chain 3 beta | |
|
2 | 2 | ||||||
| MIRT617635 | RXRA | retinoid X receptor alpha | |
|
2 | 2 | ||||||
| MIRT618058 | PCDH19 | protocadherin 19 | |
|
2 | 2 | ||||||
| MIRT618747 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | |
|
2 | 2 | ||||||
| MIRT623739 | GRIN2B | glutamate ionotropic receptor NMDA type subunit 2B | |
|
2 | 2 | ||||||
| MIRT629609 | NOL10 | nucleolar protein 10 | |
|
2 | 2 | ||||||
| MIRT635219 | CD59 | CD59 molecule (CD59 blood group) | |
|
2 | 2 | ||||||
| MIRT638035 | SHPK | sedoheptulokinase | |
|
2 | 2 | ||||||
| MIRT638545 | KIAA1549 | KIAA1549 | |
|
2 | 2 | ||||||
| MIRT645853 | AFF2 | AF4/FMR2 family member 2 | |
|
2 | 2 | ||||||
| MIRT646023 | S100A7A | S100 calcium binding protein A7A | |
|
2 | 2 | ||||||
| MIRT646562 | ALDH5A1 | aldehyde dehydrogenase 5 family member A1 | |
|
2 | 2 | ||||||
| MIRT646735 | FADS1 | fatty acid desaturase 1 | |
|
2 | 2 | ||||||
| MIRT652853 | TACC1 | transforming acidic coiled-coil containing protein 1 | |
|
2 | 2 | ||||||
| MIRT654754 | PRKCB | protein kinase C beta | |
|
2 | 2 | ||||||
| MIRT655238 | PEX26 | peroxisomal biogenesis factor 26 | |
|
2 | 2 | ||||||
| MIRT655627 | ONECUT1 | one cut homeobox 1 | |
|
2 | 2 | ||||||
| MIRT655892 | NEK9 | NIMA related kinase 9 | |
|
2 | 2 | ||||||
| MIRT656184 | MON1B | MON1 homolog B, secretory trafficking associated | |
|
2 | 2 | ||||||
| MIRT656551 | LZIC | leucine zipper and CTNNBIP1 domain containing | |
|
2 | 2 | ||||||
| MIRT657743 | GNG12 | G protein subunit gamma 12 | |
|
2 | 2 | ||||||
| MIRT659981 | C2CD2L | C2CD2 like | |
|
2 | 2 | ||||||
| MIRT660824 | AGO3 | argonaute 3, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT663511 | AGMO | alkylglycerol monooxygenase | |
|
2 | 2 | ||||||
| MIRT666613 | REEP2 | receptor accessory protein 2 | |
|
2 | 2 | ||||||
| MIRT668266 | FOXO3 | forkhead box O3 | |
|
2 | 2 | ||||||
| MIRT669395 | BACE2 | beta-site APP-cleaving enzyme 2 | |
|
2 | 2 | ||||||
| MIRT669512 | ARHGAP26 | Rho GTPase activating protein 26 | |
|
2 | 2 | ||||||
| MIRT678895 | TTLL12 | tubulin tyrosine ligase like 12 | |
|
2 | 2 | ||||||
| MIRT685122 | ADAT1 | adenosine deaminase, tRNA specific 1 | |
|
2 | 2 | ||||||
| MIRT685674 | PSMB7 | proteasome subunit beta 7 | |
|
2 | 2 | ||||||
| MIRT690647 | RPF2 | ribosome production factor 2 homolog | |
|
2 | 2 | ||||||
| MIRT697114 | OTUD5 | OTU deubiquitinase 5 | |
|
2 | 2 | ||||||
| MIRT697742 | USP5 | ubiquitin specific peptidase 5 | |
|
2 | 2 | ||||||
| MIRT698584 | TEX261 | testis expressed 261 | |
|
2 | 2 | ||||||
| MIRT700075 | RNF38 | ring finger protein 38 | |
|
2 | 2 | ||||||
| MIRT709340 | ZNF35 | zinc finger protein 35 | |
|
2 | 2 | ||||||
| MIRT711071 | NLGN2 | neuroligin 2 | |
|
2 | 2 | ||||||
| MIRT714634 | TM4SF18 | transmembrane 4 L six family member 18 | |
|
2 | 2 | ||||||
| MIRT715421 | SPOPL | speckle type BTB/POZ protein like | |
|
2 | 2 | ||||||
| MIRT718663 | HNF4A | hepatocyte nuclear factor 4 alpha | |
|
2 | 2 | ||||||
| MIRT718931 | TRIM66 | tripartite motif containing 66 | |
|
2 | 2 | ||||||
| MIRT720640 | ELF5 | E74 like ETS transcription factor 5 | |
|
2 | 2 | ||||||
| MIRT720788 | PRKRIP1 | PRKR interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT721289 | TRABD2A | TraB domain containing 2A | |
|
2 | 2 | ||||||
| MIRT722893 | LRRC20 | leucine rich repeat containing 20 | |
|
2 | 2 | ||||||
| MIRT724307 | KCNH1 | potassium voltage-gated channel subfamily H member 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|