pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6509 |
Genomic Coordinates | chr7: 135206994 - 135207078 |
Description | Homo sapiens miR-6509 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6509-3p | |||||||||||||||||||||||||||||||||
Sequence | 52| UUCCACUGCCACUACCUAAUUU |73 | |||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TUBB2A | ||||||||||||||||||||
Synonyms | CDCBM5, TUBB, TUBB2 | ||||||||||||||||||||
Description | tubulin beta 2A class IIa | ||||||||||||||||||||
Transcript | NM_001069 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TUBB2A | |||||||||||||||||||||
3'UTR of TUBB2A (miRNA target sites are highlighted) |
>TUBB2A|NM_001069|3'UTR 1 AAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCTGTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTG 81 CTCAGTTTTGCCTCTGTTAGAAATTCACACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTG 161 AAGGTATCTATACTAATAAAAAAGCATGTGTAGAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C8166 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000327892.8 | 3UTR | AAUCCUUCCCUUUCCAACUCUACCUCCCUCACUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT055374 | PDCD4 | programmed cell death 4 | 2 | 4 | ||||||||
MIRT378341 | MARCKS | myristoylated alanine rich protein kinase C substrate | 2 | 2 | ||||||||
MIRT444668 | CDKL2 | cyclin dependent kinase like 2 | 2 | 2 | ||||||||
MIRT446953 | CD248 | CD248 molecule | 2 | 2 | ||||||||
MIRT460332 | CAMK4 | calcium/calmodulin dependent protein kinase IV | 2 | 6 | ||||||||
MIRT464078 | VPS4A | vacuolar protein sorting 4 homolog A | 2 | 2 | ||||||||
MIRT464586 | UBN2 | ubinuclein 2 | 2 | 2 | ||||||||
MIRT468482 | SESN3 | sestrin 3 | 2 | 2 | ||||||||
MIRT468962 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | 2 | 2 | ||||||||
MIRT475455 | HSPA8 | heat shock protein family A (Hsp70) member 8 | 2 | 2 | ||||||||
MIRT482403 | ADRB1 | adrenoceptor beta 1 | 2 | 10 | ||||||||
MIRT486992 | ZFAND2B | zinc finger AN1-type containing 2B | 2 | 2 | ||||||||
MIRT489397 | TUBB2A | tubulin beta 2A class IIa | 2 | 2 | ||||||||
MIRT526319 | UGT2A1 | UDP glucuronosyltransferase family 2 member A1 complex locus | 2 | 2 | ||||||||
MIRT526560 | UGT2A2 | UDP glucuronosyltransferase family 2 member A2 | 2 | 2 | ||||||||
MIRT526732 | ZNF138 | zinc finger protein 138 | 2 | 8 | ||||||||
MIRT531581 | STXBP5L | syntaxin binding protein 5 like | 2 | 2 | ||||||||
MIRT532011 | NOX5 | NADPH oxidase 5 | 2 | 2 | ||||||||
MIRT533407 | TXLNG | taxilin gamma | 2 | 2 | ||||||||
MIRT533436 | TRPC5 | transient receptor potential cation channel subfamily C member 5 | 2 | 2 | ||||||||
MIRT533866 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | 2 | 2 | ||||||||
MIRT539254 | ANKRD50 | ankyrin repeat domain 50 | 2 | 2 | ||||||||
MIRT541451 | C15orf48 | chromosome 15 open reading frame 48 | 2 | 2 | ||||||||
MIRT566794 | MIER3 | MIER family member 3 | 2 | 2 | ||||||||
MIRT569294 | SURF6 | surfeit 6 | 2 | 2 | ||||||||
MIRT571336 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | 2 | 2 | ||||||||
MIRT572802 | PPP3CB | protein phosphatase 3 catalytic subunit beta | 2 | 2 | ||||||||
MIRT572813 | MYO1C | myosin IC | 2 | 2 | ||||||||
MIRT574219 | DMRT2 | doublesex and mab-3 related transcription factor 2 | 2 | 2 | ||||||||
MIRT607259 | GRAMD1B | GRAM domain containing 1B | 2 | 4 | ||||||||
MIRT609307 | CHD4 | chromodomain helicase DNA binding protein 4 | 2 | 2 | ||||||||
MIRT615459 | REPS1 | RALBP1 associated Eps domain containing 1 | 2 | 2 | ||||||||
MIRT616861 | RPLP1 | ribosomal protein lateral stalk subunit P1 | 2 | 2 | ||||||||
MIRT619415 | NOS1AP | nitric oxide synthase 1 adaptor protein | 2 | 2 | ||||||||
MIRT619652 | COX19 | COX19, cytochrome c oxidase assembly factor | 2 | 2 | ||||||||
MIRT625325 | TNFRSF13B | TNF receptor superfamily member 13B | 2 | 2 | ||||||||
MIRT638980 | ARFIP2 | ADP ribosylation factor interacting protein 2 | 2 | 2 | ||||||||
MIRT639458 | ZNF429 | zinc finger protein 429 | 2 | 2 | ||||||||
MIRT640550 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | 2 | 2 | ||||||||
MIRT641473 | B4GALNT3 | beta-1,4-N-acetyl-galactosaminyltransferase 3 | 2 | 2 | ||||||||
MIRT642720 | ATXN3 | ataxin 3 | 2 | 2 | ||||||||
MIRT643048 | SMN1 | survival of motor neuron 1, telomeric | 2 | 2 | ||||||||
MIRT644921 | SMN2 | survival of motor neuron 2, centromeric | 2 | 2 | ||||||||
MIRT645875 | ZNF275 | zinc finger protein 275 | 2 | 2 | ||||||||
MIRT649824 | LIPG | lipase G, endothelial type | 2 | 2 | ||||||||
MIRT649851 | GYS2 | glycogen synthase 2 | 2 | 2 | ||||||||
MIRT649972 | TRAFD1 | TRAF-type zinc finger domain containing 1 | 2 | 2 | ||||||||
MIRT650675 | ZNF259 | ZPR1 zinc finger | 1 | 1 | ||||||||
MIRT651319 | ZCCHC2 | zinc finger CCHC-type containing 2 | 2 | 2 | ||||||||
MIRT652876 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | 2 | 2 | ||||||||
MIRT652881 | SYVN1 | synoviolin 1 | 2 | 2 | ||||||||
MIRT654144 | RPAP2 | RNA polymerase II associated protein 2 | 2 | 2 | ||||||||
MIRT657080 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 2 | ||||||||
MIRT657181 | INO80C | INO80 complex subunit C | 2 | 2 | ||||||||
MIRT657830 | GJD3 | gap junction protein delta 3 | 2 | 2 | ||||||||
MIRT657897 | GDF7 | growth differentiation factor 7 | 2 | 2 | ||||||||
MIRT659631 | CDKN2AIP | CDKN2A interacting protein | 2 | 2 | ||||||||
MIRT663115 | SPTA1 | spectrin alpha, erythrocytic 1 | 2 | 2 | ||||||||
MIRT664739 | METTL16 | methyltransferase like 16 | 2 | 2 | ||||||||
MIRT667551 | LRAT | lecithin retinol acyltransferase | 2 | 2 | ||||||||
MIRT668552 | ERCC1 | ERCC excision repair 1, endonuclease non-catalytic subunit | 2 | 2 | ||||||||
MIRT682893 | XIAP | X-linked inhibitor of apoptosis | 2 | 2 | ||||||||
MIRT683092 | PRRG4 | proline rich and Gla domain 4 | 2 | 2 | ||||||||
MIRT683102 | TIMM10B | translocase of inner mitochondrial membrane 10B | 2 | 2 | ||||||||
MIRT697648 | WNK1 | WNK lysine deficient protein kinase 1 | 2 | 2 | ||||||||
MIRT709158 | ZNF419 | zinc finger protein 419 | 2 | 2 | ||||||||
MIRT713220 | RCAN2 | regulator of calcineurin 2 | 2 | 2 | ||||||||
MIRT713277 | LAIR1 | leukocyte associated immunoglobulin like receptor 1 | 2 | 2 | ||||||||
MIRT715008 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | 2 | 2 | ||||||||
MIRT715051 | SYNJ2BP | synaptojanin 2 binding protein | 2 | 2 | ||||||||
MIRT715696 | PNMAL2 | paraneoplastic Ma antigen family member 8B | 2 | 2 | ||||||||
MIRT717250 | TMEM246 | transmembrane protein 246 | 2 | 2 | ||||||||
MIRT717322 | PGK1 | phosphoglycerate kinase 1 | 2 | 2 | ||||||||
MIRT717587 | MTHFD1L | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like | 2 | 2 | ||||||||
MIRT718122 | CHST4 | carbohydrate sulfotransferase 4 | 2 | 2 | ||||||||
MIRT718418 | CALN1 | calneuron 1 | 2 | 2 | ||||||||
MIRT718750 | ZNF490 | zinc finger protein 490 | 2 | 2 | ||||||||
MIRT720048 | PPP1R3F | protein phosphatase 1 regulatory subunit 3F | 2 | 2 | ||||||||
MIRT721497 | THRB | thyroid hormone receptor beta | 2 | 2 | ||||||||
MIRT722531 | EPRS | glutamyl-prolyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT723279 | KRTAP21-2 | keratin associated protein 21-2 | 2 | 2 | ||||||||
MIRT724813 | MSX2 | msh homeobox 2 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|