pre-miRNA Information
pre-miRNA hsa-mir-6509   
Genomic Coordinates chr7: 135206994 - 135207078
Description Homo sapiens miR-6509 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6509-3p
Sequence 52| UUCCACUGCCACUACCUAAUUU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778601614 1 dbSNP
rs754554776 3 dbSNP
rs767798995 3 dbSNP
rs145322812 4 dbSNP
rs773941257 5 dbSNP
rs768273593 9 dbSNP
rs984565062 12 dbSNP
rs748872915 13 dbSNP
rs774861125 14 dbSNP
rs13241975 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TUBB2A   
Synonyms CDCBM5, TUBB, TUBB2
Description tubulin beta 2A class IIa
Transcript NM_001069   
Expression
Putative miRNA Targets on TUBB2A
3'UTR of TUBB2A
(miRNA target sites are highlighted)
>TUBB2A|NM_001069|3'UTR
   1 AAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCTGTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTG
  81 CTCAGTTTTGCCTCTGTTAGAAATTCACACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTG
 161 AAGGTATCTATACTAATAAAAAAGCATGTGTAGAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uuUAAU-CCAUCACCGUCACCUu 5'
            ||||  ||| || | ||| | 
Target 5' aaATTACAGTATTGTCTGTGAAg 3'
141 - 163 104.00 -5.80
2
miRNA  3' uuuaauccaucaccguCACCUu 5'
                          ||||| 
Target 5' ctgttgatgtaatgatGTGGAa 3'
110 - 131 100.00 -8.40
3
miRNA  3' uuUAAUCCAUCAC-CGUCAccuu 5'
            | ||  |:|||  ||||    
Target 5' aaACTA--TGGTGCTCAGTtttg 3'
70 - 90 92.00 -5.76
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19707453 7 COSMIC
COSN31599363 25 COSMIC
COSN26642981 30 COSMIC
COSN20051078 35 COSMIC
COSN30156040 45 COSMIC
COSN30477550 46 COSMIC
COSN30189948 48 COSMIC
COSN5087217 59 COSMIC
COSN30517455 81 COSMIC
COSN30482986 92 COSMIC
COSN30157219 94 COSMIC
COSN31516465 94 COSMIC
COSN30532241 129 COSMIC
COSN31610034 142 COSMIC
COSN31602309 145 COSMIC
COSN31586849 156 COSMIC
COSN30126712 163 COSMIC
COSN31539629 171 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777062028 2 dbSNP
rs1252088773 4 dbSNP
rs764492313 5 dbSNP
rs759149588 6 dbSNP
rs766895377 9 dbSNP
rs1397798395 11 dbSNP
rs773699055 12 dbSNP
rs770665341 16 dbSNP
rs762463562 18 dbSNP
rs760987108 19 dbSNP
rs956741889 20 dbSNP
rs773170649 21 dbSNP
rs1432943135 22 dbSNP
rs1309515144 30 dbSNP
rs769656196 35 dbSNP
rs1324165071 36 dbSNP
rs1412040819 37 dbSNP
rs72843326 38 dbSNP
rs781346126 39 dbSNP
rs1277042627 40 dbSNP
rs768447032 40 dbSNP
rs1262495570 43 dbSNP
rs1168505608 45 dbSNP
rs375083268 49 dbSNP
rs562932953 55 dbSNP
rs1003032383 56 dbSNP
rs1273018772 59 dbSNP
rs969477381 61 dbSNP
rs1168000696 64 dbSNP
rs1044651891 65 dbSNP
rs1477387363 68 dbSNP
rs1429230661 85 dbSNP
rs145215507 90 dbSNP
rs1481646522 94 dbSNP
rs1240156252 95 dbSNP
rs1475003382 96 dbSNP
rs898507927 101 dbSNP
rs1420258461 104 dbSNP
rs1038351981 106 dbSNP
rs3205007 107 dbSNP
rs3205008 109 dbSNP
rs1162928094 110 dbSNP
rs1270046583 114 dbSNP
rs1394023142 116 dbSNP
rs749283603 123 dbSNP
rs1436295732 125 dbSNP
rs1430597906 127 dbSNP
rs540952596 127 dbSNP
rs1196476950 138 dbSNP
rs777633833 145 dbSNP
rs933837370 151 dbSNP
rs866944719 154 dbSNP
rs921055081 155 dbSNP
rs772818777 162 dbSNP
rs1281832024 163 dbSNP
rs1446236775 165 dbSNP
rs1281342050 167 dbSNP
rs975362341 174 dbSNP
rs1484689874 179 dbSNP
rs1345973720 180 dbSNP
rs1417269875 190 dbSNP
rs533112511 197 dbSNP
rs747853799 198 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000327892.8 | 3UTR | AAUCCUUCCCUUUCCAACUCUACCUCCCUCACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055374 PDCD4 programmed cell death 4 2 4
MIRT378341 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT444668 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446953 CD248 CD248 molecule 2 2
MIRT460332 CAMK4 calcium/calmodulin dependent protein kinase IV 2 6
MIRT464078 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464586 UBN2 ubinuclein 2 2 2
MIRT468482 SESN3 sestrin 3 2 2
MIRT468962 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT475455 HSPA8 heat shock protein family A (Hsp70) member 8 2 2
MIRT482403 ADRB1 adrenoceptor beta 1 2 10
MIRT486992 ZFAND2B zinc finger AN1-type containing 2B 2 2
MIRT489397 TUBB2A tubulin beta 2A class IIa 2 2
MIRT526319 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526560 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526732 ZNF138 zinc finger protein 138 2 8
MIRT531581 STXBP5L syntaxin binding protein 5 like 2 2
MIRT532011 NOX5 NADPH oxidase 5 2 2
MIRT533407 TXLNG taxilin gamma 2 2
MIRT533436 TRPC5 transient receptor potential cation channel subfamily C member 5 2 2
MIRT533866 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT539254 ANKRD50 ankyrin repeat domain 50 2 2
MIRT541451 C15orf48 chromosome 15 open reading frame 48 2 2
MIRT566794 MIER3 MIER family member 3 2 2
MIRT569294 SURF6 surfeit 6 2 2
MIRT571336 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT572802 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT572813 MYO1C myosin IC 2 2
MIRT574219 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT607259 GRAMD1B GRAM domain containing 1B 2 4
MIRT609307 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT615459 REPS1 RALBP1 associated Eps domain containing 1 2 2
MIRT616861 RPLP1 ribosomal protein lateral stalk subunit P1 2 2
MIRT619415 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT619652 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT625325 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT638980 ARFIP2 ADP ribosylation factor interacting protein 2 2 2
MIRT639458 ZNF429 zinc finger protein 429 2 2
MIRT640550 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT641473 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642720 ATXN3 ataxin 3 2 2
MIRT643048 SMN1 survival of motor neuron 1, telomeric 2 2
MIRT644921 SMN2 survival of motor neuron 2, centromeric 2 2
MIRT645875 ZNF275 zinc finger protein 275 2 2
MIRT649824 LIPG lipase G, endothelial type 2 2
MIRT649851 GYS2 glycogen synthase 2 2 2
MIRT649972 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650675 ZNF259 ZPR1 zinc finger 1 1
MIRT651319 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT652876 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT652881 SYVN1 synoviolin 1 2 2
MIRT654144 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT657080 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657181 INO80C INO80 complex subunit C 2 2
MIRT657830 GJD3 gap junction protein delta 3 2 2
MIRT657897 GDF7 growth differentiation factor 7 2 2
MIRT659631 CDKN2AIP CDKN2A interacting protein 2 2
MIRT663115 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT664739 METTL16 methyltransferase like 16 2 2
MIRT667551 LRAT lecithin retinol acyltransferase 2 2
MIRT668552 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT682893 XIAP X-linked inhibitor of apoptosis 2 2
MIRT683092 PRRG4 proline rich and Gla domain 4 2 2
MIRT683102 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT697648 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT709158 ZNF419 zinc finger protein 419 2 2
MIRT713220 RCAN2 regulator of calcineurin 2 2 2
MIRT713277 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT715008 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715051 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT715696 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT717250 TMEM246 transmembrane protein 246 2 2
MIRT717322 PGK1 phosphoglycerate kinase 1 2 2
MIRT717587 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT718122 CHST4 carbohydrate sulfotransferase 4 2 2
MIRT718418 CALN1 calneuron 1 2 2
MIRT718750 ZNF490 zinc finger protein 490 2 2
MIRT720048 PPP1R3F protein phosphatase 1 regulatory subunit 3F 2 2
MIRT721497 THRB thyroid hormone receptor beta 2 2
MIRT722531 EPRS glutamyl-prolyl-tRNA synthetase 2 2
MIRT723279 KRTAP21-2 keratin associated protein 21-2 2 2
MIRT724813 MSX2 msh homeobox 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6509-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6509-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6509-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6509-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6509-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission