pre-miRNA Information
pre-miRNA hsa-mir-3160-1   
Genomic Coordinates chr11: 46451805 - 46451889
Description Homo sapiens miR-3160-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3160-2   
Genomic Coordinates chr11: 46451807 - 46451887
Description Homo sapiens miR-3160-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3160-3p
Sequence 54| AGAGCUGAGACUAGAAAGCCCA |75
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30582333 1 COSMIC
COSN1535547 3 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1396368683 1 dbSNP
rs1162409303 2 dbSNP
rs1404378453 12 dbSNP
rs1171960732 14 dbSNP
rs1324633375 16 dbSNP
rs1187765019 16 dbSNP
rs1300058326 19 dbSNP
rs1432898407 21 dbSNP
rs1011279103 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TUBB2A   
Synonyms CDCBM5, TUBB, TUBB2
Description tubulin beta 2A class IIa
Transcript NM_001069   
Expression
Putative miRNA Targets on TUBB2A
3'UTR of TUBB2A
(miRNA target sites are highlighted)
>TUBB2A|NM_001069|3'UTR
   1 AAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCTGTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTG
  81 CTCAGTTTTGCCTCTGTTAGAAATTCACACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTG
 161 AAGGTATCTATACTAATAAAAAAGCATGTGTAGAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acccgaaAGAUCA-GAGUCGAGa 5'
                 | |:|| |||||:|: 
Target 5' tgtaaacTATGGTGCTCAGTTTt 3'
67 - 89 123.00 -12.70
2
miRNA  3' acccgaaagaucAGAGUCGAGa 5'
                      |||||| || 
Target 5' -------aaactTCTCAGATCa 3'
1 - 15 118.00 -7.40
3
miRNA  3' acccGAA-AGAUCA-GAG-UCGaga 5'
              ||| | | || ||| |||   
Target 5' tgaaCTTCTGTTGTCCTCAAGCatg 3'
31 - 55 86.00 -6.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19707453 7 COSMIC
COSN31599363 25 COSMIC
COSN26642981 30 COSMIC
COSN20051078 35 COSMIC
COSN30156040 45 COSMIC
COSN30477550 46 COSMIC
COSN30189948 48 COSMIC
COSN5087217 59 COSMIC
COSN30517455 81 COSMIC
COSN30482986 92 COSMIC
COSN30157219 94 COSMIC
COSN31516465 94 COSMIC
COSN30532241 129 COSMIC
COSN31610034 142 COSMIC
COSN31602309 145 COSMIC
COSN31586849 156 COSMIC
COSN30126712 163 COSMIC
COSN31539629 171 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777062028 2 dbSNP
rs1252088773 4 dbSNP
rs764492313 5 dbSNP
rs759149588 6 dbSNP
rs766895377 9 dbSNP
rs1397798395 11 dbSNP
rs773699055 12 dbSNP
rs770665341 16 dbSNP
rs762463562 18 dbSNP
rs760987108 19 dbSNP
rs956741889 20 dbSNP
rs773170649 21 dbSNP
rs1432943135 22 dbSNP
rs1309515144 30 dbSNP
rs769656196 35 dbSNP
rs1324165071 36 dbSNP
rs1412040819 37 dbSNP
rs72843326 38 dbSNP
rs781346126 39 dbSNP
rs1277042627 40 dbSNP
rs768447032 40 dbSNP
rs1262495570 43 dbSNP
rs1168505608 45 dbSNP
rs375083268 49 dbSNP
rs562932953 55 dbSNP
rs1003032383 56 dbSNP
rs1273018772 59 dbSNP
rs969477381 61 dbSNP
rs1168000696 64 dbSNP
rs1044651891 65 dbSNP
rs1477387363 68 dbSNP
rs1429230661 85 dbSNP
rs145215507 90 dbSNP
rs1481646522 94 dbSNP
rs1240156252 95 dbSNP
rs1475003382 96 dbSNP
rs898507927 101 dbSNP
rs1420258461 104 dbSNP
rs1038351981 106 dbSNP
rs3205007 107 dbSNP
rs3205008 109 dbSNP
rs1162928094 110 dbSNP
rs1270046583 114 dbSNP
rs1394023142 116 dbSNP
rs749283603 123 dbSNP
rs1436295732 125 dbSNP
rs1430597906 127 dbSNP
rs540952596 127 dbSNP
rs1196476950 138 dbSNP
rs777633833 145 dbSNP
rs933837370 151 dbSNP
rs866944719 154 dbSNP
rs921055081 155 dbSNP
rs772818777 162 dbSNP
rs1281832024 163 dbSNP
rs1446236775 165 dbSNP
rs1281342050 167 dbSNP
rs975362341 174 dbSNP
rs1484689874 179 dbSNP
rs1345973720 180 dbSNP
rs1417269875 190 dbSNP
rs533112511 197 dbSNP
rs747853799 198 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acccGAAAGAUCAGAG-UCGAGa 5'
              ||||| |  ||| | ||| 
Target 5' uuccCUUUCCA-ACUCUACCUCc 3'
6 - 27
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000327892.8 | 3UTR | AAUCCUUCCCUUUCCAACUCUACCUCCCUCACUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
118 hsa-miR-3160-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066658 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT075318 SF3B3 splicing factor 3b subunit 3 2 4
MIRT077083 EIF1 eukaryotic translation initiation factor 1 2 2
MIRT100381 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT135259 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT184913 ZNF268 zinc finger protein 268 2 2
MIRT218862 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT446580 FPR2 formyl peptide receptor 2 2 2
MIRT448834 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT449455 RNF13 ring finger protein 13 2 2
MIRT452284 CARD8 caspase recruitment domain family member 8 2 2
MIRT452628 FAM162A family with sequence similarity 162 member A 2 2
MIRT453454 GLG1 golgi glycoprotein 1 2 2
MIRT454188 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454434 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454575 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT455555 TRAF1 TNF receptor associated factor 1 2 6
MIRT455841 MPL MPL proto-oncogene, thrombopoietin receptor 2 6
MIRT455969 BCAS4 breast carcinoma amplified sequence 4 2 4
MIRT456805 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT457320 DUSP19 dual specificity phosphatase 19 2 2
MIRT457366 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457684 ZNF587 zinc finger protein 587 2 2
MIRT458158 LYRM4 LYR motif containing 4 2 6
MIRT458641 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT459134 FADS6 fatty acid desaturase 6 2 2
MIRT459153 NARF nuclear prelamin A recognition factor 2 4
MIRT460460 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460974 STK17B serine/threonine kinase 17b 2 2
MIRT461439 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT461507 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT462490 GSR glutathione-disulfide reductase 2 2
MIRT462638 PHF5A PHD finger protein 5A 2 2
MIRT463279 ZFX zinc finger protein, X-linked 2 2
MIRT463360 ZFAND4 zinc finger AN1-type containing 4 2 2
MIRT465777 TMOD3 tropomodulin 3 2 2
MIRT466143 TMEM120B transmembrane protein 120B 2 2
MIRT468401 SETD3 SET domain containing 3 2 2
MIRT468998 RNPS1 RNA binding protein with serine rich domain 1 2 2
MIRT471574 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT472108 NME2 NME/NM23 nucleoside diphosphate kinase 2 2 2
MIRT472125 NME1-NME2 NME1-NME2 readthrough 2 2
MIRT473020 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT473083 MORN4 MORN repeat containing 4 2 2
MIRT475598 HMGB2 high mobility group box 2 2 4
MIRT475937 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476117 GPR157 G protein-coupled receptor 157 2 2
MIRT476406 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT478003 DNAL1 dynein axonemal light chain 1 2 2
MIRT487969 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489418 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491522 IL10RA interleukin 10 receptor subunit alpha 2 2
MIRT492673 PLEC plectin 2 2
MIRT493545 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT513085 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT514009 CECR2 CECR2, histone acetyl-lysine reader 2 4
MIRT516683 ZNF860 zinc finger protein 860 2 2
MIRT518392 ZNF250 zinc finger protein 250 2 2
MIRT522683 LUZP1 leucine zipper protein 1 2 6
MIRT524488 CEP97 centrosomal protein 97 2 2
MIRT527457 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT527705 IL17REL interleukin 17 receptor E like 2 2
MIRT531647 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT532381 UMPS uridine monophosphate synthetase 2 2
MIRT532588 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT533555 TPM4 tropomyosin 4 2 2
MIRT548371 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT550250 PVR poliovirus receptor 2 2
MIRT552555 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554113 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT554131 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT561344 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT561638 RUNX3 runt related transcription factor 3 2 2
MIRT566497 PBX2P1 PBX homeobox 2 pseudogene 1 2 2
MIRT570583 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572731 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT574041 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT575231 Fut1 fucosyltransferase 1 2 2
MIRT606811 BICD2 BICD cargo adaptor 2 2 2
MIRT621016 CLSTN3 calsyntenin 3 2 2
MIRT637852 PDCL3 phosducin like 3 2 2
MIRT640477 ZNF557 zinc finger protein 557 2 2
MIRT642827 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT643887 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT664874 PCNXL2 pecanex homolog 2 2 2
MIRT680528 PRIM2 DNA primase subunit 2 2 2
MIRT680648 KIAA1456 KIAA1456 2 2
MIRT680807 ZNF578 zinc finger protein 578 2 2
MIRT680921 STX2 syntaxin 2 2 2
MIRT681112 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT681147 INTS7 integrator complex subunit 7 2 2
MIRT681966 TFCP2 transcription factor CP2 2 2
MIRT684316 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT684906 GSG2 histone H3 associated protein kinase 2 2
MIRT685499 MED16 mediator complex subunit 16 2 2
MIRT685929 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT686875 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688204 FNIP1 folliculin interacting protein 1 2 2
MIRT688791 CCNB1 cyclin B1 2 2
MIRT689227 RPS19 ribosomal protein S19 2 2
MIRT690470 ZNF33A zinc finger protein 33A 2 2
MIRT691982 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT694006 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694529 TRIM72 tripartite motif containing 72 2 2
MIRT695420 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT695784 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT697799 UBXN2A UBX domain protein 2A 2 2
MIRT698275 TMEM2 transmembrane protein 2 2 2
MIRT698317 TMEM136 transmembrane protein 136 2 2
MIRT699971 RREB1 ras responsive element binding protein 1 2 2
MIRT700717 PNO1 partner of NOB1 homolog 2 2
MIRT701721 MTMR12 myotubularin related protein 12 2 2
MIRT701879 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT702959 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT706178 ZNF716 zinc finger protein 716 2 2
MIRT706463 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT718154 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT718711 ANKRD18A ankyrin repeat domain 18A 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3160-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3160-3p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-3160-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3160-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission