pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6818 |
Genomic Coordinates | chr22: 30007049 - 30007113 |
Description | Homo sapiens miR-6818 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6818-5p | ||||||||||||||||||
Sequence | 6| UUGUGUGAGUACAGAGAGCAUC |27 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TERF2IP | ||||||||||||||||||||
Synonyms | DRIP5, RAP1 | ||||||||||||||||||||
Description | TERF2 interacting protein | ||||||||||||||||||||
Transcript | NM_018975 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TERF2IP | |||||||||||||||||||||
3'UTR of TERF2IP (miRNA target sites are highlighted) |
>TERF2IP|NM_018975|3'UTR 1 TTGGCAAGATAATGAGAAAAGAAAAAAGTCATGGTAGGTGAGGTGGTTAAAAAAAATTGTGACCAATGAACTTTAGAGAG 81 TTCTTGCATTGGAACTGGCACTTATTTTCTGACCATCGCTGCTGTTGCTCTGTGAGTCCTAGATTTTTGTAGCCAAGCAG 161 AGTTGTAGAGGGGGATAAAAAGAAAAGAAATTGGATGTATTTACAGCTGTCCTTGAACAAGTATCAATGTGTTTATGAAA 241 GGAAGATCTAAATCAGACAGGAGTTGGTCTACATAGTAGTAATCCATTGTTGGAATGGAACCCTTGCTATAGTAGTGACA 321 AAGTGAAAGGAAATTTAGGAGGCATAGGCCATTTCAGGCAGCATAAGTAATCTCCTGTCCTTTGGCAGAAGCTCCTTTAG 401 ATTGGGATAGATTCCAAATAAAGAATCTAGAAATAGGAGAAGATTTAATTATGAGGCCTTGAACACGGATTATCCCCAAA 481 CCCTTGTCATTTCCCCCAGTGAGCTCTGATTTCTAGACTGCTTTGAAAATGCTGTATTCATTTTGCTAACTTAGTATTTG 561 GGTACCCTGCTCTTTGGCTGTTCTTTTTTTGGAGCCCTTCTCAGTCAAGTCTGCCGGATGTCTTTCTTTACCTACCCCTC 641 AGTTTTCCTTAAAACGCGCACACAACTCTAGAGAGTGTTAAGAATAATGTTACTTGGTTAATGTGTTATTTATTGAGTAT 721 TGTTTGTGCTAAGCATTGTGTTAGATTTAAAAAATTAGTGGATTGACTCCACTTTGTTGTGTTGTTTTCATTGTTGAAAA 801 TAAATATAACTTTGTATTCGAGTCTCGTCAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 54386.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000300086.4 | 3UTR | UUUCCUUAAAACGCGCACACAACUCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000300086.4 | 3UTR | UUUUCCUUAAAACGCGCACACAACUCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000300086.4 | 3UTR | UUUUCCUUAAAACGCGCACACAACUCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
140 hsa-miR-6818-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT071796 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT077120 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT079951 | RNF138 | ring finger protein 138 | ![]() |
![]() |
2 | 2 | ||||||
MIRT102968 | EN2 | engrailed homeobox 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT115694 | MGRN1 | mahogunin ring finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT121074 | FGFRL1 | fibroblast growth factor receptor like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT143171 | GLYR1 | glyoxylate reductase 1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT145635 | LASP1 | LIM and SH3 protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT282026 | ARID3B | AT-rich interaction domain 3B | ![]() |
![]() |
2 | 6 | ||||||
MIRT301684 | EP300 | E1A binding protein p300 | ![]() |
![]() |
2 | 2 | ||||||
MIRT328627 | AKIRIN1 | akirin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT340977 | IPO5 | importin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT371401 | STC2 | stanniocalcin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT378008 | TMED7 | transmembrane p24 trafficking protein 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT445185 | CCDC88C | coiled-coil domain containing 88C | ![]() |
![]() |
2 | 2 | ||||||
MIRT447120 | DUSP16 | dual specificity phosphatase 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449153 | SORCS2 | sortilin related VPS10 domain containing receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450200 | ABHD15 | abhydrolase domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453853 | ZNF12 | zinc finger protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459077 | LSM1 | LSM1 homolog, mRNA degradation associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT461304 | MRPS27 | mitochondrial ribosomal protein S27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464137 | VPS28 | VPS28, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT468114 | SH3PXD2A | SH3 and PX domains 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT471401 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478220 | DDX52 | DExD-box helicase 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479695 | CCNT1 | cyclin T1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479779 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484980 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT485016 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT485034 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 8 | ||||||
MIRT485221 | PRICKLE1 | prickle planar cell polarity protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490143 | TERF2IP | TERF2 interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT508908 | DOK6 | docking protein 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT513877 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515966 | C9orf156 | tRNA methyltransferase O | ![]() |
![]() |
2 | 4 | ||||||
MIRT517892 | CHAF1B | chromatin assembly factor 1 subunit B | ![]() |
![]() |
2 | 4 | ||||||
MIRT518660 | CLVS2 | clavesin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT520027 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT523884 | EPHA5 | EPH receptor A5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT529237 | PORCN | porcupine O-acyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT535337 | PFN1 | profilin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537532 | EZR | ezrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT537695 | ELOVL6 | ELOVL fatty acid elongase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538494 | CLOCK | clock circadian regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT539140 | ARHGAP35 | Rho GTPase activating protein 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541380 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT545018 | PLP1 | proteolipid protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547732 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548257 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550372 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551867 | TMEM47 | transmembrane protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552289 | SNAP29 | synaptosome associated protein 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552902 | VSNL1 | visinin like 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT552990 | VAMP4 | vesicle associated membrane protein 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554729 | RHOC | ras homolog family member C | ![]() |
![]() |
2 | 2 | ||||||
MIRT555301 | PPP3CB | protein phosphatase 3 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT556832 | KATNAL1 | katanin catalytic subunit A1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557523 | GPBP1L1 | GC-rich promoter binding protein 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558238 | EDA2R | ectodysplasin A2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT558920 | CBX1 | chromobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559198 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559611 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559769 | URGCP-MRPS24 | URGCP-MRPS24 readthrough | ![]() |
![]() |
2 | 4 | ||||||
MIRT564648 | ZNF487P | zinc finger protein 487 | ![]() |
1 | 1 | |||||||
MIRT565856 | NHS | NHS actin remodeling regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT569044 | ZNF655 | zinc finger protein 655 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569154 | SIGMAR1 | sigma non-opioid intracellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569166 | DMD | dystrophin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569205 | CASZ1 | castor zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569264 | BRWD3 | bromodomain and WD repeat domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569431 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569476 | CTSE | cathepsin E | ![]() |
![]() |
2 | 2 | ||||||
MIRT570232 | NCAN | neurocan | ![]() |
![]() |
2 | 2 | ||||||
MIRT570519 | SHH | sonic hedgehog | ![]() |
![]() |
2 | 2 | ||||||
MIRT570680 | FZD5 | frizzled class receptor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572161 | CRK | CRK proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT575142 | Cd93 | CD93 antigen | ![]() |
![]() |
2 | 3 | ||||||
MIRT575644 | Mitf | microphthalmia-associated transcription factor | ![]() |
![]() |
2 | 3 | ||||||
MIRT575653 | Synpo | synaptopodin | ![]() |
![]() |
2 | 4 | ||||||
MIRT576375 | Runx1t1 | runt-related transcription factor 1; translocated to, 1 (cyclin D-related) | ![]() |
![]() |
2 | 2 | ||||||
MIRT576388 | Fhl2 | four and a half LIM domains 2 | ![]() |
![]() |
2 | 3 | ||||||
MIRT576413 | Pla2g16 | phospholipase A2, group XVI | ![]() |
![]() |
2 | 2 | ||||||
MIRT576697 | Hps3 | HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT606872 | CHST11 | carbohydrate sulfotransferase 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT606940 | GFRA1 | GDNF family receptor alpha 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT607025 | ZEB1 | zinc finger E-box binding homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607028 | PPY | pancreatic polypeptide | ![]() |
![]() |
2 | 4 | ||||||
MIRT607081 | MITF | melanogenesis associated transcription factor | ![]() |
![]() |
2 | 3 | ||||||
MIRT607769 | HS6ST3 | heparan sulfate 6-O-sulfotransferase 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT607881 | SATB1 | SATB homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607996 | BTBD9 | BTB domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608124 | TSC22D2 | TSC22 domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608132 | TGFBR2 | transforming growth factor beta receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608209 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608337 | SPN | sialophorin | ![]() |
![]() |
2 | 2 | ||||||
MIRT608416 | SYNPO | synaptopodin | ![]() |
![]() |
2 | 5 | ||||||
MIRT608459 | CD93 | CD93 molecule | ![]() |
![]() |
2 | 3 | ||||||
MIRT608555 | SBK1 | SH3 domain binding kinase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT608585 | PPP2R1B | protein phosphatase 2 scaffold subunit Abeta | ![]() |
![]() |
2 | 4 | ||||||
MIRT608785 | JAKMIP2 | janus kinase and microtubule interacting protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT608791 | CDH12 | cadherin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608816 | ONECUT3 | one cut homeobox 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT608876 | CNTF | ciliary neurotrophic factor | ![]() |
![]() |
2 | 6 | ||||||
MIRT608881 | CLIC6 | chloride intracellular channel 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608894 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608954 | GIMAP1 | GTPase, IMAP family member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT609007 | HPS3 | HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT609045 | INVS | inversin | ![]() |
![]() |
2 | 4 | ||||||
MIRT619037 | CASS4 | Cas scaffolding protein family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625226 | RPSAP58 | ribosomal protein SA pseudogene 58 | ![]() |
![]() |
2 | 4 | ||||||
MIRT625545 | GABRB2 | gamma-aminobutyric acid type A receptor beta2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627333 | TTLL7 | tubulin tyrosine ligase like 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627954 | NLK | nemo like kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT629280 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT634982 | TNFAIP8 | TNF alpha induced protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646129 | C1orf147 | chromosome 1 open reading frame 147 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646370 | SLC22A6 | solute carrier family 22 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652743 | TGFA | transforming growth factor alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT653984 | SEMA6A | semaphorin 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT660038 | C15orf61 | chromosome 15 open reading frame 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663504 | NKAPL | NFKB activating protein like | ![]() |
![]() |
2 | 4 | ||||||
MIRT667117 | OCIAD2 | OCIA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683747 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683922 | SLC43A3 | solute carrier family 43 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684101 | LHFP | LHFPL tetraspan subfamily member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684224 | FGF14 | fibroblast growth factor 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685560 | SRD5A3 | steroid 5 alpha-reductase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687408 | NRXN1 | neurexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687467 | NHSL2 | NHS like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687695 | LEPREL1 | prolyl 3-hydroxylase 2 | ![]() |
1 | 1 | |||||||
MIRT688094 | GLRA3 | glycine receptor alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688255 | FHL2 | four and a half LIM domains 2 | ![]() |
![]() |
2 | 3 | ||||||
MIRT688851 | CAMKK2 | calcium/calmodulin dependent protein kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700293 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704679 | CHST2 | carbohydrate sulfotransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706392 | PPID | peptidylprolyl isomerase D | ![]() |
![]() |
2 | 2 | ||||||
MIRT707388 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707509 | PPP1R16B | protein phosphatase 1 regulatory subunit 16B | ![]() |
![]() |
2 | 2 | ||||||
MIRT709808 | AR | androgen receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT715491 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|