>HAAO|NM_012205|3'UTR
   1 CCCTCTTGCCATGGCCTGAAGCAGCCACAGGTGTGCCAAGCACCCTCGAGTGCCATCCCTGCCAAACAACTCTCCCAGCC
  81 CCCACTACCTCTCTGTGTACTGCCGCTGTGTCCCCCACAGACCTGCACATTGTTGTCACCCACCCTCCTGCCCTTCTCAG
 161 CCCAGATGCCATGCCCCTGGGCGGGCAGCAGCTCCCCATCTTCTCTGGCAGACTCAGCCCACTGCCTTGCCAGTCTTGCC
 241 AGGTGGTCTACCCCCGGCCCCGCTCCTGCCCATTCCTCTGTCCCTGCAGACTCAGTGCAGCACTTCCACACCAAGAAGGC
 321 CCTCAATAAAGGCTTCCTGAGGAACGCAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuguUGUUUAG---GGU----CAGAUGGa 5' :| |:|| ||| ||||||| Target 5' ccttGCCAGTCTTGCCAGGTGGTCTACCc 3'	225 - 253	148.00	-13.60
2	miRNA 3' uuGUUGUUUAGGGUCAGAUGGa 5' || :| ||:| || |||: Target 5' ccCACTACCTCTCTGTGTACTg 3'	81 - 102	112.00	-11.01
3	miRNA 3' uuGUUGUUUAGGGUCAGAUGGa 5' | :|| ||: : ||| ||| Target 5' acCTGCACATTGTTGTC-ACCc 3'	121 - 141	104.00	-6.50

Mutant ID	Mutant Position	Mutant Source
COSN30503389	3	COSMIC
COSN24308882	30	COSMIC
COSN28674995	93	COSMIC
COSN30169398	110	COSMIC
COSN32058634	123	COSMIC
COSN31997890	163	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs747866500	2	dbSNP
rs941009250	4	dbSNP
rs778641306	5	dbSNP
rs1322971407	8	dbSNP
rs1201831397	9	dbSNP
rs1468064904	13	dbSNP
rs754516175	14	dbSNP
rs1173157112	16	dbSNP
rs753415999	21	dbSNP
rs769557534	21	dbSNP
rs1450262670	25	dbSNP
rs1250141339	28	dbSNP
rs202170808	30	dbSNP
rs1445091500	32	dbSNP
rs367576716	35	dbSNP
rs757808783	36	dbSNP
rs1486652798	38	dbSNP
rs1277561556	40	dbSNP
rs752059080	44	dbSNP
rs780395028	45	dbSNP
rs376184741	47	dbSNP
rs748119098	48	dbSNP
rs1412220425	52	dbSNP
rs887035387	54	dbSNP
rs747462488	63	dbSNP
rs1208842136	64	dbSNP
rs560529070	67	dbSNP
rs13032819	72	dbSNP
rs915299873	79	dbSNP
rs755743718	80	dbSNP
rs575179578	81	dbSNP
rs558462022	82	dbSNP
rs1322242544	83	dbSNP
rs140886094	88	dbSNP
rs959634558	89	dbSNP
rs2304661	93	dbSNP
rs1312832736	95	dbSNP
rs1210813266	96	dbSNP
rs928342811	104	dbSNP
rs1250659250	105	dbSNP
rs572904356	105	dbSNP
rs17630329	106	dbSNP
rs766256498	114	dbSNP
rs534003426	116	dbSNP
rs772915794	117	dbSNP
rs59439781	120	dbSNP
rs1426735031	122	dbSNP
rs958252339	128	dbSNP
rs1414542326	132	dbSNP
rs897013229	134	dbSNP
rs1017073935	136	dbSNP
rs1005339230	137	dbSNP
rs1365269407	137	dbSNP
rs1403397478	139	dbSNP
rs1032418114	145	dbSNP
rs1175867178	148	dbSNP
rs1368448739	151	dbSNP
rs1214035518	156	dbSNP
rs1459947441	157	dbSNP
rs1305725044	158	dbSNP
rs1207125432	165	dbSNP
rs1275110760	167	dbSNP
rs189702623	168	dbSNP
rs1219887766	174	dbSNP
rs1049386755	175	dbSNP
rs1478098308	178	dbSNP
rs2304660	182	dbSNP
rs761954910	183	dbSNP
rs1451886882	186	dbSNP
rs1169768737	189	dbSNP
rs569563217	192	dbSNP
rs901398836	198	dbSNP
rs564071484	199	dbSNP
rs539324614	200	dbSNP
rs776707402	201	dbSNP
rs1350705349	205	dbSNP
rs2304659	208	dbSNP
rs376467945	212	dbSNP
rs915453165	213	dbSNP
rs1025579718	215	dbSNP
rs547202822	216	dbSNP
rs1054273243	217	dbSNP
rs1358519693	224	dbSNP
rs1243474846	230	dbSNP
rs1245731212	240	dbSNP
rs1192408699	241	dbSNP
rs995728730	245	dbSNP
rs926711135	246	dbSNP
rs529729212	250	dbSNP
rs1465857400	251	dbSNP
rs898368562	253	dbSNP
rs1264756300	255	dbSNP
rs557281139	256	dbSNP
rs1343972224	258	dbSNP
rs1055467437	262	dbSNP
rs535740922	263	dbSNP
rs1165390932	273	dbSNP
rs1414888804	278	dbSNP
rs1277047028	282	dbSNP
rs780577227	287	dbSNP
rs1400352791	292	dbSNP
rs1229493741	294	dbSNP
rs1391013563	295	dbSNP
rs906968875	298	dbSNP
rs560693855	305	dbSNP
rs1321199338	306	dbSNP
rs1381973991	312	dbSNP
rs1295556118	317	dbSNP
rs1450308569	319	dbSNP
rs1285740325	321	dbSNP
rs970715298	343	dbSNP
rs1281657346	345	dbSNP
rs550149722	346	dbSNP
rs1208832018	349	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.