pre-miRNA Information
pre-miRNA hsa-mir-4436b-1   
Genomic Coordinates chr2: 110086433 - 110086523
Description Homo sapiens miR-4436b-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-4436b-2   
Genomic Coordinates chr2: 110284853 - 110284943
Description Homo sapiens miR-4436b-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4436b-3p
Sequence 60| CAGGGCAGGAAGAAGUGGACAA |81
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760150076 9 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UPK2   
Synonyms UP2, UPII
Description uroplakin 2
Transcript NM_006760   
Expression
Putative miRNA Targets on UPK2
3'UTR of UPK2
(miRNA target sites are highlighted)
>UPK2|NM_006760|3'UTR
   1 GGAGGTCTGCCCGGAGCAGCAGCTTCTCCAGGAAGCCCAGGGCACCATCCAGCTCCCCAGCCCACCTGCTCCCAGGCCCC
  81 AGGCCTGTGGCTCCCTTGGTGCCCTCGCCTCCTCCTCCTGCCCTCCTCTCCCCTAGAGCCCTCTCCTCCCTCTGTCCCTC
 161 TCCTTGCCCCCAGTGCCTCACCTTCCAACACTCCATTATTCCTCTCACCCCACTCCTGTCAGAGTTGACTTTCCTCCCAT
 241 TTTACCACTTTAAACACCCCCATAACAATTCCCCCATCCTTCAGTGAACTAAGTCCCTATAATAAAGGCTGAGGCTGCAT
 321 CTGCCAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aacaGGUGAAGAAGGACGGGAc 5'
              || | || ||||||||| 
Target 5' ctcgCCTCCTCCTCCTGCCCTc 3'
104 - 125 166.00 -20.60
2
miRNA  3' aaCAGGUGAAGAAGGACGGGac 5'
            |||| | ||| |:|||||  
Target 5' ctGTCC-C-TCTCCTTGCCCcc 3'
152 - 171 130.00 -20.00
3
miRNA  3' aacaggugaagaaGGACGGGac 5'
                       :||||||  
Target 5' --------ggaggTCTGCCCgg 3'
1 - 14 121.00 -11.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30474526 3 COSMIC
COSN13304898 13 COSMIC
COSN30153773 15 COSMIC
COSN31511415 23 COSMIC
COSN30513770 62 COSMIC
COSN31569510 108 COSMIC
COSN28201418 224 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1317025336 6 dbSNP
rs1217401588 8 dbSNP
rs142311603 9 dbSNP
rs201943136 13 dbSNP
rs369208895 14 dbSNP
rs1244859178 23 dbSNP
rs1468582048 25 dbSNP
rs1176573402 39 dbSNP
rs761736578 42 dbSNP
rs769688736 47 dbSNP
rs1174532074 50 dbSNP
rs1428939088 51 dbSNP
rs889249572 57 dbSNP
rs982059389 61 dbSNP
rs1035847208 65 dbSNP
rs547344002 67 dbSNP
rs1437766949 70 dbSNP
rs1328758867 71 dbSNP
rs958731109 71 dbSNP
rs1199350615 76 dbSNP
rs1360179652 78 dbSNP
rs1043263105 80 dbSNP
rs1209449151 88 dbSNP
rs1354584627 89 dbSNP
rs1288254292 99 dbSNP
rs991171912 104 dbSNP
rs45528741 107 dbSNP
rs941664065 108 dbSNP
rs971694513 115 dbSNP
rs1313303187 117 dbSNP
rs919207379 118 dbSNP
rs773516299 122 dbSNP
rs1031648331 126 dbSNP
rs933233852 127 dbSNP
rs1360706201 131 dbSNP
rs960046748 133 dbSNP
rs1229357860 135 dbSNP
rs539455136 136 dbSNP
rs1052061544 137 dbSNP
rs1272036525 150 dbSNP
rs1478917898 160 dbSNP
rs748553477 161 dbSNP
rs1198333164 168 dbSNP
rs1488746601 172 dbSNP
rs1265546790 174 dbSNP
rs1023479348 195 dbSNP
rs879937158 209 dbSNP
rs867886643 212 dbSNP
rs1221432514 213 dbSNP
rs770234189 214 dbSNP
rs1343406754 241 dbSNP
rs1274647472 256 dbSNP
rs1382194467 260 dbSNP
rs970203913 261 dbSNP
rs1340780179 262 dbSNP
rs1299623008 263 dbSNP
rs942781798 264 dbSNP
rs1397651902 268 dbSNP
rs1344074205 276 dbSNP
rs763487009 276 dbSNP
rs1176784275 290 dbSNP
rs1039771759 298 dbSNP
rs1416103989 314 dbSNP
rs551367658 315 dbSNP
rs984360706 319 dbSNP
rs909745212 324 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' aacaGGUGAAGAAGGACGGGAc 5'
              || | || ||||||||| 
Target 5' cucgCCUCCUCCUCCUGCCCUc 3'
4 - 25
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903830
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_b
Location of target site NM_006760 | 3UTR | CUCGCCUCCUCCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903831
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / 124TD_shELAVL3_a
Location of target site NM_006760 | 3UTR | CUCGCCUCCUCCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000264031.2 | 3UTR | GCCCUCGCCUCCUCCUCCUGCCCUCCUCUCCCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066957 ATXN7L3B ataxin 7 like 3B 2 8
MIRT119284 NABP1 nucleic acid binding protein 1 2 6
MIRT128915 KMT2A lysine methyltransferase 2A 2 2
MIRT150116 MIDN midnolin 2 2
MIRT173040 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT253117 BCL2L12 BCL2 like 12 2 2
MIRT256997 RGMB repulsive guidance molecule family member b 2 2
MIRT259746 SNX12 sorting nexin 12 2 2
MIRT267278 TMEM109 transmembrane protein 109 2 2
MIRT441934 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT443625 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT445757 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT447835 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT451230 ZNF444 zinc finger protein 444 2 2
MIRT451966 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453127 HOXC4 homeobox C4 2 2
MIRT454604 RPL13A ribosomal protein L13a 2 2
MIRT455176 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455547 GJB1 gap junction protein beta 1 2 2
MIRT458197 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT458356 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458923 DNM2 dynamin 2 2 2
MIRT461013 SYT7 synaptotagmin 7 2 2
MIRT461643 ZSWIM4 zinc finger SWIM-type containing 4 2 2
MIRT461997 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462367 BCL7B BCL tumor suppressor 7B 2 2
MIRT464915 TXNIP thioredoxin interacting protein 2 2
MIRT466311 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466591 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467045 SRSF1 serine and arginine rich splicing factor 1 2 2
MIRT468750 SDC2 syndecan 2 2 2
MIRT468943 RPS24 ribosomal protein S24 2 2
MIRT469474 REEP5 receptor accessory protein 5 2 2
MIRT469913 PTRF caveolae associated protein 1 2 2
MIRT473325 MEX3A mex-3 RNA binding family member A 2 2
MIRT473643 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474064 LMNB2 lamin B2 2 2
MIRT474357 KMT2D lysine methyltransferase 2D 2 2
MIRT475394 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476335 GLTSCR1L BRD4 interacting chromatin remodeling complex associated protein like 2 2
MIRT478651 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479585 CDC42SE1 CDC42 small effector 1 2 2
MIRT479943 CBX5 chromobox 5 2 2
MIRT482001 AMOTL2 angiomotin like 2 2 2
MIRT482043 AMER1 APC membrane recruitment protein 1 2 2
MIRT483070 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484323 KCNH1 potassium voltage-gated channel subfamily H member 1 2 4
MIRT487528 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT489636 ALS2CL ALS2 C-terminal like 2 2
MIRT490693 SSTR1 somatostatin receptor 1 2 2
MIRT490871 UPK2 uroplakin 2 2 2
MIRT492582 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492945 NEUROD2 neuronal differentiation 2 2 2
MIRT498675 SOD2 superoxide dismutase 2 2 4
MIRT499349 RAB25 RAB25, member RAS oncogene family 2 2
MIRT502338 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT502976 CCNL1 cyclin L1 2 8
MIRT503706 NUP62 nucleoporin 62 2 2
MIRT505567 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT507808 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT513242 FBXO41 F-box protein 41 2 6
MIRT513586 EVX1 even-skipped homeobox 1 2 2
MIRT525036 FRK fyn related Src family tyrosine kinase 2 2
MIRT531035 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 2 2
MIRT531939 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT534912 PUM2 pumilio RNA binding family member 2 2 2
MIRT535717 N4BP1 NEDD4 binding protein 1 2 2
MIRT540498 ZMAT4 zinc finger matrin-type 4 2 4
MIRT541465 AURKA aurora kinase A 2 2
MIRT554328 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT561572 SLC6A9 solute carrier family 6 member 9 2 2
MIRT564715 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT576176 Hmox1 heme oxygenase 1 2 2
MIRT629712 XKR4 XK related 4 2 2
MIRT636182 THBD thrombomodulin 2 2
MIRT646315 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT649174 IQSEC1 IQ motif and Sec7 domain 1 2 2
MIRT666945 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT684057 FOLR1 folate receptor 1 2 2
MIRT687585 MAU2 MAU2 sister chromatid cohesion factor 2 2
MIRT689953 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT704071 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT704327 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT705406 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT710488 CDH5 cadherin 5 2 2
MIRT718241 LCE1A late cornified envelope 1A 2 2
MIRT723182 CDCA4 cell division cycle associated 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4436b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4436b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission