>MRPL34|NM_023937|3'UTR
   1 GGATCGCGACGCAGTCGGCGGGACCCTCATGGAAGCATCGCCCTCGCCTCGGACCTTGCCTGGCGCTATTTTTGCAGGGA
  81 GCTGGGGAGCAGGAACGCCTCGGACCTGAGTGCTCTCCATATTGTGGGGTTGAAGTCTGGATGGGAGCTTGCCAAGTCCC
 161 TTTTTAGGCTTTTTAATTAGGAAGCATTTCGAACCTGCGCAACAGACCAAAGAACAGTACAAAGAACATCCGTGTACCCA
 241 GTACCCTGACTACCGACTACCTACAACCCGTCCCTGCCCCATCCTGAGTTCTTTTGAAGCTGATCTCAGGCATCGGATTA
 321 TTTCTTCTGTAAATATTTCAGAATGTATCTCTCCAAGATGAGAGCTCATTAAAAGACAATTACAAAGCTTATCACATCCA
 401 AAAGAATTATCAATAATTTTGAAATATTATTAAACGTGTAATAAATGTTCAAAGTTCCACTTGC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuuuagagaugucuuCGGGGUAu 5' ||||||| Target 5' ctacaacccgtccctGCCCCATc 3'	261 - 283	140.00	-11.92
2	miRNA 3' cuuuagAGAUGUCUUCGGGGUAu 5' || :|:|:| ||:||| Target 5' acgcagTCGGCGGGACCCTCATg 3'	9 - 31	117.00	-16.60
3	miRNA 3' cuUUAGAGAUGUCUUCGGGGUau 5' ||| |: || |||::||| Target 5' taAATGTT--CA-AAGTTCCAct 3'	442 - 461	108.00	-7.00

Mutant ID	Mutant Position	Mutant Source
COSN31538947	41	COSMIC
COSN30513199	68	COSMIC
COSN28195016	98	COSMIC
COSN28865089	166	COSMIC
COSN32056007	191	COSMIC
COSN21843390	318	COSMIC
COSN6138826	443	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs752128680	2	dbSNP
rs553287368	6	dbSNP
rs113881312	9	dbSNP
rs567182216	16	dbSNP
rs775226742	19	dbSNP
rs1306502144	21	dbSNP
rs1202012640	24	dbSNP
rs1242309642	25	dbSNP
rs1234073161	26	dbSNP
rs1235939361	27	dbSNP
rs762892120	28	dbSNP
rs763546639	31	dbSNP
rs1185140241	38	dbSNP
rs1251027685	41	dbSNP
rs773882196	42	dbSNP
rs1172931853	44	dbSNP
rs1337342256	46	dbSNP
rs1418542511	47	dbSNP
rs1051157112	49	dbSNP
rs761362721	51	dbSNP
rs1401364143	52	dbSNP
rs891222128	56	dbSNP
rs2288464	65	dbSNP
rs1343485607	67	dbSNP
rs1037070369	73	dbSNP
rs182592588	77	dbSNP
rs1415170836	80	dbSNP
rs868045144	87	dbSNP
rs1407461949	92	dbSNP
rs898738297	94	dbSNP
rs144555991	104	dbSNP
rs1044076185	106	dbSNP
rs1187723662	110	dbSNP
rs905536916	114	dbSNP
rs1023657482	117	dbSNP
rs930367667	118	dbSNP
rs564763374	120	dbSNP
rs1003461549	127	dbSNP
rs1212328242	129	dbSNP
rs1034736706	132	dbSNP
rs533367911	133	dbSNP
rs1271090480	137	dbSNP
rs1283071559	143	dbSNP
rs868201061	146	dbSNP
rs547221034	148	dbSNP
rs1288714794	154	dbSNP
rs1232528097	161	dbSNP
rs1353469371	161	dbSNP
rs113679687	169	dbSNP
rs1019188556	182	dbSNP
rs544569057	191	dbSNP
rs1195925420	198	dbSNP
rs1316434756	199	dbSNP
rs996172102	200	dbSNP
rs1413058081	208	dbSNP
rs558325863	217	dbSNP
rs566716672	226	dbSNP
rs967920486	231	dbSNP
rs979346987	238	dbSNP
rs1472812436	246	dbSNP
rs921190872	250	dbSNP
rs932466112	253	dbSNP
rs1240990388	255	dbSNP
rs1051371515	256	dbSNP
rs1031534663	264	dbSNP
rs1448366398	267	dbSNP
rs1268435172	273	dbSNP
rs1212778783	291	dbSNP
rs1332423290	325	dbSNP
rs578144449	328	dbSNP
rs770172681	331	dbSNP
rs546010040	336	dbSNP
rs1268485779	348	dbSNP
rs187111045	352	dbSNP
rs773606046	354	dbSNP
rs1424904096	360	dbSNP
rs988645617	372	dbSNP
rs192025106	377	dbSNP
rs6903	378	dbSNP
rs1397168946	380	dbSNP
rs1165987756	388	dbSNP
rs1428408564	395	dbSNP
rs898478826	396	dbSNP
rs182918642	397	dbSNP
rs779144283	407	dbSNP
rs748672533	415	dbSNP
rs1184247312	427	dbSNP
rs758921554	436	dbSNP
rs1450809025	448	dbSNP
rs530435720	456	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.