>VGF|NM_003378|3'UTR
   1 CTGCCCTTCCCGGTCCCGCCCCCGCGCGCCCCCGCCGCGCGCGCGCGCCGGCGCCCCCCTCCGTGTTGCCCGCTCCCCCT
  81 CGGTGTTTGCATGCGCCCCGGCCCTGCCCCTTGGCCCTGCCCCTGTCCCCGGGCTGCGTCGGGACCTGCCAGACCCCCCT
 161 CCCGGGTCCTGAGCCCGAACTCCCAGAGCTCACCCGCGGGTGACCGGGGGCCAGCCCAGGAGGGCGGGTGGTTTGTGCGA
 241 GTTCCCTTGCCACGCGGGGCCCCGGCCCCATCAAGTCCCTCTGGGGACGTCCCCGTCGGAAACCGGAAAAAGCAGTTCCA
 321 GTTAATTGTGTGAAGTGTGTCTGTCTCCAGCCCTTCGGGCCTCCCACGAGCCCCTCCAGCCTCTCCAAGTCGCTGTGAAT
 401 TGACCCCTTCTTTCCTTTCTCTGTTGTAAATACCCCTCACGGAGGAAATAGTTTTGCTAAGAAATAAAAGTGACTATTTT
 481 ATTAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' gacGAGGCUCGU---GCCGGCGCGc 5' | ||| ||: | ||||||| Target 5' cgcCCCCGCGCGCCCCCGCCGCGCg 3'	17 - 41	155.00	-27.70
2	miRNA 3' gaCGAGGCUCGUG--CCGGCGCGc 5' || || : | | |||:|||: Target 5' ctGCCCCTGTCCCCGGGCTGCGTc 3'	117 - 140	122.00	-19.00
3	miRNA 3' gacgAGGCUC---GUGCCGGCGCGc 5' | |||| | : ||| ||| Target 5' tttgTGCGAGTTCCCTTGCCACGCg 3'	232 - 256	118.00	-19.30

Mutant ID	Mutant Position	Mutant Source
COSN30529835	2	COSMIC
COSN27004601	19	COSMIC
COSN27004602	20	COSMIC
COSN30646161	36	COSMIC
COSN24310986	113	COSMIC
COSN30670199	206	COSMIC
COSN30541763	230	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs957958709	1	dbSNP
rs1487721484	3	dbSNP
rs770089706	5	dbSNP
rs574477804	11	dbSNP
rs1032220775	12	dbSNP
rs1284094424	18	dbSNP
rs762359570	19	dbSNP
rs771811708	19	dbSNP
rs752200712	26	dbSNP
rs972871257	28	dbSNP
rs1301231332	30	dbSNP
rs1318021589	32	dbSNP
rs1228011232	33	dbSNP
rs1329913517	34	dbSNP
rs764988113	36	dbSNP
rs745345037	38	dbSNP
rs759227426	39	dbSNP
rs778522822	40	dbSNP
rs776590939	41	dbSNP
rs1215476799	43	dbSNP
rs1300074477	43	dbSNP
rs867998937	43	dbSNP
rs902335415	45	dbSNP
rs1463004810	47	dbSNP
rs1030453096	49	dbSNP
rs770611627	49	dbSNP
rs1343522333	50	dbSNP
rs760707757	50	dbSNP
rs773019846	50	dbSNP
rs1304009681	51	dbSNP
rs768837064	51	dbSNP
rs1367644777	54	dbSNP
rs1455691595	55	dbSNP
rs1472638408	56	dbSNP
rs559485433	58	dbSNP
rs1365129064	59	dbSNP
rs1378339714	59	dbSNP
rs1305434578	60	dbSNP
rs749383214	60	dbSNP
rs1350911554	71	dbSNP
rs1431771833	71	dbSNP
rs1238754377	72	dbSNP
rs1267161168	73	dbSNP
rs1181023391	75	dbSNP
rs1438141311	79	dbSNP
rs1490735125	80	dbSNP
rs1219191617	82	dbSNP
rs1214849300	84	dbSNP
rs1470271067	87	dbSNP
rs773827695	89	dbSNP
rs1266798365	95	dbSNP
rs756747525	101	dbSNP
rs753777397	103	dbSNP
rs1198564472	105	dbSNP
rs1378361641	106	dbSNP
rs1281461021	109	dbSNP
rs1040031502	110	dbSNP
rs944456574	111	dbSNP
rs777866017	116	dbSNP
rs1231403854	120	dbSNP
rs1330289862	121	dbSNP
rs1422983470	125	dbSNP
rs1485132172	125	dbSNP
rs1323078588	126	dbSNP
rs755905793	130	dbSNP
rs912940238	132	dbSNP
rs989391610	138	dbSNP
rs752605591	140	dbSNP
rs1319829064	141	dbSNP
rs957593474	142	dbSNP
rs926112477	150	dbSNP
rs980344767	154	dbSNP
rs1386545585	155	dbSNP
rs1170421293	156	dbSNP
rs970270933	157	dbSNP
rs1377419315	158	dbSNP
rs867236981	159	dbSNP
rs775479850	160	dbSNP
rs1288641250	161	dbSNP
rs1455873600	161	dbSNP
rs1024274088	163	dbSNP
rs757510647	164	dbSNP
rs770032327	164	dbSNP
rs1447636042	168	dbSNP
rs540842583	172	dbSNP
rs1198945577	173	dbSNP
rs1344502331	177	dbSNP
rs961763231	179	dbSNP
rs1281329144	180	dbSNP
rs1236153454	186	dbSNP
rs928793428	189	dbSNP
rs1245059724	193	dbSNP
rs767612486	195	dbSNP
rs1309581616	197	dbSNP
rs1296738804	199	dbSNP
rs1435785181	201	dbSNP
rs1327665200	206	dbSNP
rs1331705775	208	dbSNP
rs759842912	209	dbSNP
rs868168937	210	dbSNP
rs1402413522	211	dbSNP
rs751763107	211	dbSNP
rs1394715444	222	dbSNP
rs1175161565	225	dbSNP
rs1339199256	226	dbSNP
rs1436938721	232	dbSNP
rs1375070928	239	dbSNP
rs1388760804	242	dbSNP
rs766434888	245	dbSNP
rs1384389936	248	dbSNP
rs1015646103	255	dbSNP
rs1445120373	257	dbSNP
rs1283277017	261	dbSNP
rs916309784	263	dbSNP
rs990487246	280	dbSNP
rs1058351	281	dbSNP
rs957657609	291	dbSNP
rs1032293874	297	dbSNP
rs1204252492	298	dbSNP
rs978410886	304	dbSNP
rs1440813989	307	dbSNP
rs576697919	308	dbSNP
rs34907591	312	dbSNP
rs887658951	312	dbSNP
rs1049352650	318	dbSNP
rs1242973339	321	dbSNP
rs1030563995	324	dbSNP
rs1476512033	329	dbSNP
rs1368339065	335	dbSNP
rs73712100	342	dbSNP
rs184655571	356	dbSNP
rs1244003273	371	dbSNP
rs1040063529	373	dbSNP
rs539407810	378	dbSNP
rs1400652910	381	dbSNP
rs575223120	385	dbSNP
rs1456589971	386	dbSNP
rs1412304964	387	dbSNP
rs1006187896	388	dbSNP
rs887772194	391	dbSNP
rs944319016	402	dbSNP
rs1422206923	408	dbSNP
rs369818277	408	dbSNP
rs529022474	408	dbSNP
rs1275861496	410	dbSNP
rs748792118	421	dbSNP
rs758982088	431	dbSNP
rs1223869373	433	dbSNP
rs1190963020	437	dbSNP
rs1342768751	449	dbSNP
rs907397954	454	dbSNP
rs1052911358	460	dbSNP
rs1285051005	466	dbSNP
rs1355574746	472	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.