pre-miRNA Information
pre-miRNA hsa-mir-3689d-1   
Genomic Coordinates chr9: 134849609 - 134849682
Description Homo sapiens miR-3689d-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3689d-2   
Genomic Coordinates chr9: 134850277 - 134850356
Description Homo sapiens miR-3689d-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689d
Sequence 2| GGGAGGUGUGAUCUCACACUCG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551722268 8 dbSNP
rs143142996 8 dbSNP
rs1236297052 12 dbSNP
rs573148947 14 dbSNP
rs1210004979 14 dbSNP
rs1217460444 14 dbSNP
rs762590109 18 dbSNP
rs574332265 18 dbSNP
rs1164353021 21 dbSNP
rs963741171 21 dbSNP
rs1177416877 22 dbSNP
rs765777344 22 dbSNP
Putative Targets

Gene Information
Gene Symbol SOCS1   
Synonyms CIS1, CISH1, JAB, SOCS-1, SSI-1, SSI1, TIP-3, TIP3
Description suppressor of cytokine signaling 1
Transcript NM_003745   
Expression
Putative miRNA Targets on SOCS1
3'UTR of SOCS1
(miRNA target sites are highlighted)
>SOCS1|NM_003745|3'UTR
   1 CCGGCAGCGCCCGCCGTGCACGCAGCATTAACTGGGATGCCGTGTTATTTTGTTATTACTTGCCTGGAACCATGTGGGTA
  81 CCCTCCCCGGCCTGGGTTGGAGGGAGCGGATGGGTGTAGGGGCGAGGCGCCTCCCGCCCTCGGCTGGAGACGAGGCCGCA
 161 GACCCCTTCTCACCTCTTGAGGGGGTCCTCCCCCTCCTGGTGCTCCCTCTGGGTCCCCCTGGTTGTTGTAGCAGCTTAAC
 241 TGTATCTGGAGCCAGGACCTGAACTCGCACCTCCTACCTCTTCATGTTTACATATACCCAGTATCTTTGCACAAACCAGG
 321 GGTTGGGGGAGGGTCTCTGGCTTTATTTTTCTGCTGTGCAGAATCCTATTTTATATTTTTTAAAGTCAGTTTAGGTAATA
 401 AACTTTATTATGAAAGTTTTTTTTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gcucacACUCUAGUGUGGAGGg 5'
                |||  ||:||||||| 
Target 5' aggaccTGAACTCGCACCTCCt 3'
254 - 275 160.00 -19.60
2
miRNA  3' gcUCACACUCUAG---UGUGGAGGg 5'
            :|||| :|: |   :|:||||| 
Target 5' tgGGTGTAGGGGCGAGGCGCCTCCc 3'
111 - 135 140.00 -26.90
3
miRNA  3' gcucacacucuAGUGUGGAGGg 5'
                     || ||||||: 
Target 5' cgcagacccctTCTCACCTCTt 3'
157 - 178 131.00 -11.72
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30509282 12 COSMIC
COSN30464270 14 COSMIC
COSN26562149 19 COSMIC
COSN30608640 21 COSMIC
COSN30529940 29 COSMIC
COSN8390891 32 COSMIC
COSN25331100 35 COSMIC
COSN8390890 36 COSMIC
COSN30512718 37 COSMIC
COSN23180549 40 COSMIC
COSN30537242 44 COSMIC
COSN30536542 63 COSMIC
COSN23179492 70 COSMIC
COSN23232246 77 COSMIC
COSN8390889 95 COSMIC
COSN8390888 109 COSMIC
COSN8390887 114 COSMIC
COSN17076123 117 COSMIC
COSN20078546 136 COSMIC
COSN17078495 141 COSMIC
COSN30535143 141 COSMIC
COSN31481604 141 COSMIC
COSN23257295 145 COSMIC
COSN25427610 165 COSMIC
COSN8390886 173 COSMIC
COSN25173747 230 COSMIC
COSN25425286 231 COSMIC
COSN8390885 237 COSMIC
COSN16270723 247 COSMIC
COSN8390884 278 COSMIC
COSN23067211 305 COSMIC
COSN28734426 368 COSMIC
COSN25488480 395 COSMIC
COSN26023882 426 COSMIC
COSN28757433 427 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778677913 2 dbSNP
rs757285172 3 dbSNP
rs1218199147 4 dbSNP
rs1801729 10 dbSNP
rs1317802340 15 dbSNP
rs749758679 18 dbSNP
rs1226687366 19 dbSNP
rs1223745134 20 dbSNP
rs368764480 21 dbSNP
rs1284497148 22 dbSNP
rs1404642989 23 dbSNP
rs375518583 32 dbSNP
rs1291058297 41 dbSNP
rs754605093 42 dbSNP
rs1344278387 43 dbSNP
rs751180131 44 dbSNP
rs1011299449 47 dbSNP
rs370928470 48 dbSNP
rs1398986729 50 dbSNP
rs760814084 50 dbSNP
rs1205398863 51 dbSNP
rs577171732 52 dbSNP
rs753605441 52 dbSNP
rs575199723 54 dbSNP
rs1342978690 55 dbSNP
rs1347743269 55 dbSNP
rs777439416 56 dbSNP
rs1287277976 59 dbSNP
rs1370544856 60 dbSNP
rs1399877155 62 dbSNP
rs907461367 62 dbSNP
rs1366614108 63 dbSNP
rs1165294305 66 dbSNP
rs1007953682 67 dbSNP
rs1368113640 69 dbSNP
rs558316619 70 dbSNP
rs1200461226 71 dbSNP
rs538539048 73 dbSNP
rs1004847464 75 dbSNP
rs572828363 78 dbSNP
rs996948668 79 dbSNP
rs1226493080 81 dbSNP
rs1487884183 82 dbSNP
rs879102216 83 dbSNP
rs887761913 85 dbSNP
rs898407449 88 dbSNP
rs1049625966 92 dbSNP
rs552720624 95 dbSNP
rs1211397750 96 dbSNP
rs1307040512 97 dbSNP
rs536056934 102 dbSNP
rs1039556584 103 dbSNP
rs1377776752 105 dbSNP
rs964236927 107 dbSNP
rs1317030463 108 dbSNP
rs912493125 109 dbSNP
rs568420700 119 dbSNP
rs1204109894 126 dbSNP
rs1056245042 127 dbSNP
rs938748385 129 dbSNP
rs1206856491 136 dbSNP
rs1227579174 136 dbSNP
rs555047093 138 dbSNP
rs1233573068 139 dbSNP
rs977299722 140 dbSNP
rs980065389 142 dbSNP
rs945719913 143 dbSNP
rs914211995 147 dbSNP
rs990333772 151 dbSNP
rs958461470 157 dbSNP
rs755754896 158 dbSNP
rs537999563 161 dbSNP
rs1218566378 163 dbSNP
rs1034517453 165 dbSNP
rs569224392 168 dbSNP
rs1326027944 169 dbSNP
rs981567045 171 dbSNP
rs1449753612 172 dbSNP
rs971503261 173 dbSNP
rs752261706 174 dbSNP
rs113432632 179 dbSNP
rs1015148445 183 dbSNP
rs1005106801 184 dbSNP
rs1031822587 186 dbSNP
rs1341187688 186 dbSNP
rs1298988341 187 dbSNP
rs1273929181 190 dbSNP
rs187731105 194 dbSNP
rs1245037668 196 dbSNP
rs1462185583 197 dbSNP
rs1188456634 199 dbSNP
rs532835330 201 dbSNP
rs1027637675 203 dbSNP
rs1371718987 205 dbSNP
rs1421581427 213 dbSNP
rs567196031 215 dbSNP
rs1028113719 217 dbSNP
rs1467892822 224 dbSNP
rs1338214964 228 dbSNP
rs1406136322 230 dbSNP
rs34927167 239 dbSNP
rs1316075297 242 dbSNP
rs1328013947 245 dbSNP
rs1274013757 249 dbSNP
rs1200783434 251 dbSNP
rs1323175685 253 dbSNP
rs530331412 259 dbSNP
rs182354564 270 dbSNP
rs1040450017 271 dbSNP
rs943857763 277 dbSNP
rs1324308340 292 dbSNP
rs1266349319 296 dbSNP
rs1205089168 298 dbSNP
rs1016613925 301 dbSNP
rs890937787 302 dbSNP
rs1194419078 304 dbSNP
rs754064101 316 dbSNP
rs887049001 319 dbSNP
rs1041666735 321 dbSNP
rs1458766148 326 dbSNP
rs1456212154 332 dbSNP
rs1056214690 345 dbSNP
rs1387121740 348 dbSNP
rs1255619051 354 dbSNP
rs939222408 363 dbSNP
rs1197456373 369 dbSNP
rs754377333 371 dbSNP
rs1343386878 375 dbSNP
rs1324938079 379 dbSNP
rs1277102650 381 dbSNP
rs1044836151 382 dbSNP
rs1346231391 391 dbSNP
rs945970861 392 dbSNP
rs914244924 394 dbSNP
rs948841688 395 dbSNP
rs544292351 399 dbSNP
rs1259031405 408 dbSNP
rs1353556478 411 dbSNP
rs1231651580 413 dbSNP
rs914531385 416 dbSNP
rs1201173704 417 dbSNP
rs1489948240 417 dbSNP
rs1269072795 418 dbSNP
rs1330920220 419 dbSNP
rs1308070327 420 dbSNP
rs1449301159 422 dbSNP
rs1398362753 424 dbSNP
rs990187265 424 dbSNP
rs115979730 425 dbSNP
rs199732720 426 dbSNP
rs1162531125 427 dbSNP
rs1491446658 427 dbSNP
rs35739545 427 dbSNP
rs796537318 427 dbSNP
rs8060459 427 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000332029.2 | 3UTR | CACCUCCUACCUCUUCAUGUUUACAUAUACCCAGUAUCUUUGCACAAACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059166 TXNIP thioredoxin interacting protein 2 4
MIRT080699 KIAA1468 KIAA1468 2 2
MIRT218770 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT278059 KHNYN KH and NYN domain containing 2 2
MIRT345933 EIF4A1 eukaryotic translation initiation factor 4A1 2 2
MIRT366238 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT449689 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT451149 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451266 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451375 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451570 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451585 HIRIP3 HIRA interacting protein 3 2 2
MIRT451614 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451763 ZNF611 zinc finger protein 611 2 6
MIRT452383 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452573 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452735 PTGES3L prostaglandin E synthase 3 like 2 6
MIRT452867 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452975 CABP4 calcium binding protein 4 2 2
MIRT453215 CERS1 ceramide synthase 1 2 2
MIRT453259 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453449 GLG1 golgi glycoprotein 1 2 2
MIRT453479 PITPNM3 PITPNM family member 3 2 2
MIRT453663 CD207 CD207 molecule 2 6
MIRT453724 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT453760 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT454181 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454330 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT454338 CDKL1 cyclin dependent kinase like 1 2 2
MIRT454427 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454665 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454825 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT455130 TBC1D25 TBC1 domain family member 25 2 2
MIRT455166 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455416 RXRB retinoid X receptor beta 2 2
MIRT455668 GLO1 glyoxalase I 2 2
MIRT455999 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456446 TMEM81 transmembrane protein 81 2 2
MIRT456642 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT456728 TMEM239 transmembrane protein 239 2 2
MIRT457131 ASPH aspartate beta-hydroxylase 2 2
MIRT457157 MXRA7 matrix remodeling associated 7 2 2
MIRT457358 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457458 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT457619 UPK3BL uroplakin 3B like 1 2 2
MIRT457692 ZNF587 zinc finger protein 587 2 2
MIRT457727 SMOX spermine oxidase 2 2
MIRT457788 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT457875 THEM6 thioesterase superfamily member 6 2 4
MIRT457909 ZNF212 zinc finger protein 212 2 2
MIRT458395 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT458496 MARVELD2 MARVEL domain containing 2 2 2
MIRT458544 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT458577 TCOF1 treacle ribosome biogenesis factor 1 2 2
MIRT458732 CES2 carboxylesterase 2 2 2
MIRT458814 ZNF843 zinc finger protein 843 2 2
MIRT458931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459341 ZNF17 zinc finger protein 17 2 2
MIRT459365 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459572 NLGN2 neuroligin 2 2 2
MIRT460015 DTX3L deltex E3 ubiquitin ligase 3L 2 4
MIRT460144 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460653 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460798 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT461058 KCNK6 potassium two pore domain channel subfamily K member 6 2 4
MIRT461458 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461572 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461927 TNFSF14 TNF superfamily member 14 2 2
MIRT461953 C3 complement C3 2 2
MIRT462278 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT462744 EFNB1 ephrin B1 2 2
MIRT463136 ZNF451 zinc finger protein 451 2 4
MIRT463566 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT463866 WNT7B Wnt family member 7B 2 2
MIRT464326 UST uronyl 2-sulfotransferase 2 2
MIRT464796 UBE2F ubiquitin conjugating enzyme E2 F (putative) 2 2
MIRT465034 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT466207 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467007 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467029 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468001 SKI SKI proto-oncogene 2 2
MIRT468031 SIKE1 suppressor of IKBKE 1 2 6
MIRT468575 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT468834 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT468970 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469450 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470888 PLXND1 plexin D1 2 2
MIRT470953 PKM pyruvate kinase, muscle 2 2
MIRT471828 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472590 NACC1 nucleus accumbens associated 1 2 2
MIRT472805 MTMR12 myotubularin related protein 12 2 2
MIRT472818 MTMR10 myotubularin related protein 10 2 6
MIRT472914 MSN moesin 2 2
MIRT474558 KLHDC3 kelch domain containing 3 2 2
MIRT474716 KIF13A kinesin family member 13A 2 6
MIRT475279 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475300 IFNLR1 interferon lambda receptor 1 2 2
MIRT475759 HDLBP high density lipoprotein binding protein 2 2
MIRT475786 HDGF heparin binding growth factor 2 2
MIRT475933 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476212 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT476238 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 4
MIRT476799 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477988 DNAL1 dynein axonemal light chain 1 2 2
MIRT478317 DDN dendrin 2 2
MIRT479257 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479344 CEP97 centrosomal protein 97 2 2
MIRT479522 CDCA4 cell division cycle associated 4 2 2
MIRT479906 CCDC117 coiled-coil domain containing 117 2 6
MIRT481147 AVL9 AVL9 cell migration associated 2 6
MIRT481735 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482089 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT482389 AEN apoptosis enhancing nuclease 2 2
MIRT483093 TFPI tissue factor pathway inhibitor 2 2
MIRT484246 ANK1 ankyrin 1 2 2
MIRT484342 EPN1 epsin 1 2 4
MIRT489141 C5orf38 chromosome 5 open reading frame 38 2 2
MIRT489163 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489547 SOX11 SRY-box 11 2 4
MIRT489780 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489799 KRT80 keratin 80 2 6
MIRT490535 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492198 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492283 SHISA6 shisa family member 6 2 4
MIRT501059 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT501094 SLC5A6 solute carrier family 5 member 6 2 4
MIRT503870 CBS cystathionine-beta-synthase 2 2
MIRT507981 BCL2L13 BCL2 like 13 2 4
MIRT508125 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT508205 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508385 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT510308 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT510462 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT512227 ATXN3 ataxin 3 2 8
MIRT512665 STEAP3 STEAP3 metalloreductase 2 2
MIRT514184 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT515053 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515138 ZNF799 zinc finger protein 799 2 4
MIRT515452 ZNF747 zinc finger protein 747 2 2
MIRT515791 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT515905 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT516129 MRPS16 mitochondrial ribosomal protein S16 2 6
MIRT516679 ZNF860 zinc finger protein 860 2 4
MIRT516750 ZNF100 zinc finger protein 100 2 2
MIRT516971 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT517491 NPAP1 nuclear pore associated protein 1 2 2
MIRT517774 PROM2 prominin 2 2 2
MIRT517938 ZNF431 zinc finger protein 431 2 4
MIRT518386 ZNF250 zinc finger protein 250 2 2
MIRT520621 TMEM41B transmembrane protein 41B 2 2
MIRT521028 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521454 RAD51 RAD51 recombinase 2 2
MIRT521564 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT521581 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT522263 NKRF NFKB repressing factor 2 2
MIRT522410 MXI1 MAX interactor 1, dimerization protein 2 2
MIRT522543 MED28 mediator complex subunit 28 2 6
MIRT522915 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT523029 IGF1 insulin like growth factor 1 2 2
MIRT523854 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT524184 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524520 CDK19 cyclin dependent kinase 19 2 2
MIRT524674 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT530257 ZNF620 zinc finger protein 620 2 2
MIRT540691 BMP3 bone morphogenetic protein 3 2 2
MIRT540976 C17orf85 nuclear cap binding subunit 3 2 2
MIRT545505 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT545631 GGCX gamma-glutamyl carboxylase 2 2
MIRT547358 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT550701 MPL MPL proto-oncogene, thrombopoietin receptor 2 4
MIRT550717 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551203 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT553999 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT561081 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT563523 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT564463 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565233 TRAF6 TNF receptor associated factor 6 2 2
MIRT566618 NKAP NFKB activating protein 2 2
MIRT569527 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569639 QPCT glutaminyl-peptide cyclotransferase 2 2
MIRT570253 SSPN sarcospan 2 2
MIRT570570 OTUD7B OTU deubiquitinase 7B 2 2
MIRT570621 MTF2 metal response element binding transcription factor 2 2 2
MIRT571098 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 2
MIRT575196 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575554 Cd99 CD99 antigen 2 2
MIRT575634 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT608267 NOP14 NOP14 nucleolar protein 2 2
MIRT609314 FXYD6 FXYD domain containing ion transport regulator 6 2 2
MIRT627670 RPL28 ribosomal protein L28 2 2
MIRT631185 TSPAN14 tetraspanin 14 2 2
MIRT631964 YIPF5 Yip1 domain family member 5 2 2
MIRT632885 GINM1 glycoprotein integral membrane 1 2 2
MIRT642618 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT645609 TSPAN6 tetraspanin 6 2 2
MIRT662227 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662329 MYLK3 myosin light chain kinase 3 2 2
MIRT662725 LRRC3C leucine rich repeat containing 3C 2 2
MIRT665520 USP14 ubiquitin specific peptidase 14 2 2
MIRT666634 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT668969 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT670925 DESI1 desumoylating isopeptidase 1 2 2
MIRT673939 ZNF500 zinc finger protein 500 2 2
MIRT674675 PLCE1 phospholipase C epsilon 1 2 2
MIRT675230 MAK male germ cell associated kinase 2 2
MIRT680864 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT681047 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681105 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT683553 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684508 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684812 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT685981 CCDC77 coiled-coil domain containing 77 2 2
MIRT686709 TBC1D19 TBC1 domain family member 19 2 2
MIRT686867 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688908 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT691208 KLHL30 kelch like family member 30 2 2
MIRT692298 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT694380 MTA1 metastasis associated 1 2 2
MIRT696497 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT700686 POLR3D RNA polymerase III subunit D 2 2
MIRT701088 PAPOLG poly(A) polymerase gamma 2 2
MIRT703373 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT706189 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT706648 SMIM19 small integral membrane protein 19 2 2
MIRT709466 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709699 DMWD DM1 locus, WD repeat containing 2 2
MIRT710693 LYRM4 LYR motif containing 4 2 2
MIRT713457 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT722409 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 2
MIRT725391 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT725548 DNMT3A DNA methyltransferase 3 alpha 2 2

Error report submission