pre-miRNA Information
pre-miRNA hsa-mir-4660   
Genomic Coordinates chr8: 9048445 - 9048518
Description Homo sapiens miR-4660 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4660
Sequence 9| UGCAGCUCUGGUGGAAAAUGGAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs559566816 2 dbSNP
rs1206645118 3 dbSNP
rs1022883625 18 dbSNP
rs968295961 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SETD1B
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gagguaaaagguggucucGACGu 5'
                            |||| 
Target 5' ----------cucccaccCUGCg 3'
1 - 13
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_015048 | 3UTR | AUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_015048 | 3UTR | CUCCAUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_015048 | 3UTR | CAUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_015048 | 3UTR | UGUGACCCGGAGUCCUCAUCAAGAUGAGCGCGCUCCAUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_015048 | 3UTR | UCCUCAUCAAGAUGAGCGCGCUCCAUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_015048 | 3UTR | AGUCCUCAUCAAGAUGAGCGCGCUCCAUGAGGGAGCUGCUCCCACCCUGCGGACGCAGGCGGCCGGAGCCUCUGGUAUCUCAGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000267197.5 | 3UTR | CUCCCACCCUGCGGACGCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
73 hsa-miR-4660 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064842 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT090784 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT163239 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT214144 LMNB1 lamin B1 2 2
MIRT292479 ZNF507 zinc finger protein 507 2 2
MIRT306038 SKIL SKI like proto-oncogene 2 2
MIRT310459 REST RE1 silencing transcription factor 2 2
MIRT329710 SCD stearoyl-CoA desaturase 2 2
MIRT457833 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 2 2
MIRT460747 SRP14 signal recognition particle 14 2 2
MIRT461545 ACTR3B ARP3 actin related protein 3 homolog B 2 4
MIRT486956 HLA-B major histocompatibility complex, class I, B 2 2
MIRT487933 HLA-C major histocompatibility complex, class I, C 2 2
MIRT490515 LIMD1 LIM domains containing 1 2 2
MIRT492314 SETD1B SET domain containing 1B 2 2
MIRT501513 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT504616 PLK1 polo like kinase 1 2 2
MIRT505714 SESN2 sestrin 2 2 2
MIRT506199 PHF19 PHD finger protein 19 2 2
MIRT506827 KIF23 kinesin family member 23 2 6
MIRT512815 ARRDC2 arrestin domain containing 2 2 4
MIRT527014 MAGI2 membrane associated guanylate kinase, WW and PDZ domain containing 2 2 4
MIRT528520 SLC1A7 solute carrier family 1 member 7 2 2
MIRT531346 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT537154 GID8 GID complex subunit 8 homolog 2 2
MIRT541104 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT543397 DROSHA drosha ribonuclease III 2 2
MIRT551860 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT554775 RHEBP1 RHEB pseudogene 1 2 4
MIRT556479 LIPA lipase A, lysosomal acid type 2 2
MIRT556662 KMT2D lysine methyltransferase 2D 2 4
MIRT558213 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT558819 CDCA4 cell division cycle associated 4 2 4
MIRT559142 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT560981 ZNF333 zinc finger protein 333 2 2
MIRT562066 KLHL15 kelch like family member 15 2 2
MIRT564703 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT565904 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT566320 POTEM POTE ankyrin domain family member M 2 2
MIRT566331 POTEG POTE ankyrin domain family member G 2 2
MIRT575253 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT609975 HERPUD2 HERPUD family member 2 2 2
MIRT614318 C1orf220 chromosome 1 open reading frame 220 2 2
MIRT618784 AGTRAP angiotensin II receptor associated protein 2 2
MIRT619894 NPTXR neuronal pentraxin receptor 2 2
MIRT631517 CTBS chitobiase 2 2
MIRT640707 MRS2 MRS2, magnesium transporter 2 2
MIRT642218 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT654661 PSMG1 proteasome assembly chaperone 1 2 2
MIRT663725 GLUL glutamate-ammonia ligase 2 2
MIRT690653 RPF2 ribosome production factor 2 homolog 2 2
MIRT703189 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT705896 ADCY9 adenylate cyclase 9 2 2
MIRT706984 XPO5 exportin 5 2 2
MIRT710566 KIAA1958 KIAA1958 2 2
MIRT712526 CYTH2 cytohesin 2 2 2
MIRT714072 RUNDC3B RUN domain containing 3B 2 2
MIRT716299 PAX1 paired box 1 2 2
MIRT716748 C19orf24 chromosome 19 open reading frame 24 2 2
MIRT716933 FAM13A family with sequence similarity 13 member A 2 2
MIRT717344 RAB40A RAB40A, member RAS oncogene family 2 2
MIRT717387 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT718298 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT718569 SLC25A22 solute carrier family 25 member 22 2 2
MIRT718642 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT718690 BTBD9 BTB domain containing 9 2 2
MIRT719650 ARL3 ADP ribosylation factor like GTPase 3 2 2
MIRT721035 TRIM67 tripartite motif containing 67 2 2
MIRT721130 TLK1 tousled like kinase 1 2 2
MIRT722968 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723114 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT723708 RNF166 ring finger protein 166 2 2
MIRT736594 MAFG MAF bZIP transcription factor G 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4660 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4660 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4660 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission