pre-miRNA Information
pre-miRNA hsa-mir-3653   
Genomic Coordinates chr22: 29333158 - 29333267
Description Homo sapiens miR-3653 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3653-5p
Sequence 23| CCUCCUGAUGAUUCUUCUUC |42
Evidence Not_experimental
Experiments
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PER1   
Synonyms PER, RIGUI, hPER
Description period circadian clock 1
Transcript NM_002616   
Expression
Putative miRNA Targets on PER1
3'UTR of PER1
(miRNA target sites are highlighted)
>PER1|NM_002616|3'UTR
   1 ACTCCATTCTGGGACCATCTCCAGGAGTCCATGAGAGGCTTTCTTCTCCTATGTCCCAATTCTCAGAACTCAGATGTGGC
  81 TAGACCAACCAGTGGGAAACTGCCCCAGCTTCTCCCACCATAGGGGGCCGGACCCCCATCACCAGCCTAGGATCCAGGGG
 161 CTGCCTCTGGCCTCTTAGGGAGCAGAGAGCAGAACTCCGCAGCCCAGCCCAGAGGAGTGTCACCTCCCACCTTTGGAGAG
 241 GAATCCTTCCCTCCCCTGGACAAAGTTGCTGACAAGCTGCTGAAGTGGCCTCTCCATATTCCAGCTGAGCCTGAATCTGA
 321 CTCTTGAGGGTTGGGGCTGCACTTATTTATTGCGGGGAGACAGCTCTCTCTCCCACCTCCTCCCCAGATGGGAGGAGAGC
 401 CTGAGGCCCAAGCAGGACCCGGGGGTTCCAGCCCCTAGCTGCTCTGGAGTGGGGGAGGTTGGTGGACCATGGAGTCCCTG
 481 GTGCTGCCCCTCAGGTGGGACCCAGGCGTTCTCAGCTGTACCCTCTGCCGATGGCATTTGTGTTTTTGATATTTGTGTCT
 561 GTTACTACTTTTTTAATACAAAAAGATAAAAACGCCCAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cuUCUUCUUAGUAGUCCUCc 5'
            :|:|  |||  |||||| 
Target 5' ctGGGACCATCTCCAGGAGt 3'
9 - 28 126.00 -12.40
2
miRNA  3' cuucuUCUUAGUAGUCCUCc 5'
               ||:|||  ||||:| 
Target 5' agcctAGGATC--CAGGGGc 3'
144 - 161 114.00 -13.10
3
miRNA  3' cuucuucuuaGUAGUCCUCc 5'
                    | ||||| | 
Target 5' tggtgctgccCCTCAGGTGg 3'
479 - 498 110.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30475836 4 COSMIC
COSN213290 5 COSMIC
COSN30133592 36 COSMIC
COSN31490619 66 COSMIC
COSN30101618 129 COSMIC
COSN24387296 130 COSMIC
COSN30183788 151 COSMIC
COSN31489441 185 COSMIC
COSN31598404 214 COSMIC
COSN1730307 372 COSMIC
COSN26603591 522 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747785629 2 dbSNP
rs781584121 6 dbSNP
rs1256692255 9 dbSNP
rs755303484 11 dbSNP
rs751878671 12 dbSNP
rs184493993 15 dbSNP
rs758770438 17 dbSNP
rs192450546 20 dbSNP
rs901543265 31 dbSNP
rs372252358 32 dbSNP
rs200753550 42 dbSNP
rs1184914456 46 dbSNP
rs762177991 49 dbSNP
rs199766819 51 dbSNP
rs763719042 51 dbSNP
rs190460119 53 dbSNP
rs141664298 69 dbSNP
rs1432135592 71 dbSNP
rs1408290215 86 dbSNP
rs1456075713 95 dbSNP
rs1445185660 111 dbSNP
rs1260897620 112 dbSNP
rs1318101054 116 dbSNP
rs1346091746 119 dbSNP
rs892696949 127 dbSNP
rs561858829 129 dbSNP
rs1007530712 130 dbSNP
rs1205532294 133 dbSNP
rs540690949 134 dbSNP
rs1325612100 135 dbSNP
rs1159731950 142 dbSNP
rs905353557 143 dbSNP
rs1045188656 144 dbSNP
rs754701694 147 dbSNP
rs572975216 155 dbSNP
rs953491150 159 dbSNP
rs1490239493 161 dbSNP
rs185558493 164 dbSNP
rs1271081045 166 dbSNP
rs1158564530 174 dbSNP
rs998175656 175 dbSNP
rs1402856690 181 dbSNP
rs1455101997 183 dbSNP
rs1163081158 185 dbSNP
rs1363360971 192 dbSNP
rs574749695 198 dbSNP
rs1303239997 199 dbSNP
rs1318205691 210 dbSNP
rs2518020 212 dbSNP
rs1383152827 214 dbSNP
rs972433935 215 dbSNP
rs1278949593 231 dbSNP
rs1041837500 234 dbSNP
rs1424261949 237 dbSNP
rs2518021 238 dbSNP
rs1225296899 246 dbSNP
rs909099769 250 dbSNP
rs984692883 251 dbSNP
rs553236705 255 dbSNP
rs1482148125 256 dbSNP
rs1181145685 257 dbSNP
rs1011297433 259 dbSNP
rs1165566429 260 dbSNP
rs1474430694 262 dbSNP
rs545814876 263 dbSNP
rs1193749199 264 dbSNP
rs1448569592 275 dbSNP
rs975865456 276 dbSNP
rs2735605 285 dbSNP
rs1055455527 290 dbSNP
rs751424398 292 dbSNP
rs1266467589 293 dbSNP
rs937045144 294 dbSNP
rs1490407271 302 dbSNP
rs1355074701 303 dbSNP
rs1293419050 310 dbSNP
rs1312664157 312 dbSNP
rs1381688244 313 dbSNP
rs1019967302 314 dbSNP
rs1317491436 322 dbSNP
rs928286339 327 dbSNP
rs1337657885 329 dbSNP
rs1045682886 330 dbSNP
rs1212296494 335 dbSNP
rs1338130017 336 dbSNP
rs575602122 341 dbSNP
rs1202253004 346 dbSNP
rs557245033 347 dbSNP
rs138015223 353 dbSNP
rs1001072272 354 dbSNP
rs574451005 355 dbSNP
rs905400904 356 dbSNP
rs1301667079 366 dbSNP
rs1404662358 367 dbSNP
rs1366435650 372 dbSNP
rs148525689 373 dbSNP
rs1411595229 382 dbSNP
rs942107000 385 dbSNP
rs552814935 389 dbSNP
rs554358640 392 dbSNP
rs1168463455 393 dbSNP
rs117098829 399 dbSNP
rs1270846496 400 dbSNP
rs1030742090 403 dbSNP
rs1221753765 409 dbSNP
rs2735606 412 dbSNP
rs1427012059 413 dbSNP
rs976371464 417 dbSNP
rs1480601316 418 dbSNP
rs567359051 420 dbSNP
rs78146161 421 dbSNP
rs1436766940 422 dbSNP
rs1373286588 424 dbSNP
rs1049046542 425 dbSNP
rs569213763 429 dbSNP
rs2735607 431 dbSNP
rs1173591912 434 dbSNP
rs1011727381 451 dbSNP
rs761825837 454 dbSNP
rs1382424452 458 dbSNP
rs1034141309 463 dbSNP
rs1319290903 469 dbSNP
rs931853215 469 dbSNP
rs921791885 487 dbSNP
rs1001683786 488 dbSNP
rs906875049 489 dbSNP
rs1225829752 497 dbSNP
rs965836825 500 dbSNP
rs1350493758 503 dbSNP
rs913002746 506 dbSNP
rs2735608 507 dbSNP
rs1045771347 508 dbSNP
rs1048750 511 dbSNP
rs1262042861 516 dbSNP
rs988504586 523 dbSNP
rs1196677460 525 dbSNP
rs879363438 529 dbSNP
rs1032629964 530 dbSNP
rs897046865 534 dbSNP
rs73972700 536 dbSNP
rs1440253226 552 dbSNP
rs1354076776 555 dbSNP
rs1329606497 566 dbSNP
rs146972914 567 dbSNP
rs1422926041 575 dbSNP
rs754029299 578 dbSNP
rs1346160328 585 dbSNP
rs1403819354 587 dbSNP
rs1305568463 588 dbSNP
rs192602532 593 dbSNP
rs986270037 594 dbSNP
rs1262810475 595 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5187.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5187.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000317276.4 | 3UTR | ACGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000317276.4 | 3UTR | UAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000317276.4 | 3UTR | ACGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000317276.4 | 3UTR | UAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000317276.4 | 3UTR | GGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000317276.4 | 3UTR | AAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000317276.4 | 3UTR | UAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000317276.4 | 3UTR | CGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUGAGUUAGCGGGGAGUGAUAUAUUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000317276.4 | 3UTR | UAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000317276.4 | 3UTR | CGCCGGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000317276.4 | 3UTR | UAAACAGGAGAUCCUGGGUUCGAAUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000317276.4 | 3UTR | UAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
543 hsa-miR-3653-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118037 SLC1A5 solute carrier family 1 member 5 2 2
MIRT134378 E2F2 E2F transcription factor 2 2 2
MIRT171365 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT174716 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT250468 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 2
MIRT261002 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 4
MIRT306045 SKIL SKI like proto-oncogene 2 4
MIRT352741 CSNK1E casein kinase 1 epsilon 2 2
MIRT380445 SLC2A1 solute carrier family 2 member 1 2 2
MIRT442181 SRP68 signal recognition particle 68 2 6
MIRT448534 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT451362 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT451444 ZNF556 zinc finger protein 556 2 4
MIRT452667 PPIA peptidylprolyl isomerase A 2 2
MIRT458768 CES2 carboxylesterase 2 2 2
MIRT460268 SLC26A2 solute carrier family 26 member 2 2 2
MIRT460535 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT460602 FEM1A fem-1 homolog A 2 4
MIRT463622 YY1 YY1 transcription factor 2 2
MIRT473708 MAPK1 mitogen-activated protein kinase 1 2 6
MIRT474922 KCTD20 potassium channel tetramerization domain containing 20 2 2
MIRT478532 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT482760 TMEM126B transmembrane protein 126B 2 2
MIRT491029 FDX1 ferredoxin 1 2 4
MIRT492753 PER1 period circadian clock 1 2 8
MIRT494140 CTC1 CST telomere replication complex component 1 2 10
MIRT497863 UBA5 ubiquitin like modifier activating enzyme 5 2 4
MIRT512405 CD84 CD84 molecule 2 2
MIRT512529 ATCAY ATCAY, caytaxin 2 4
MIRT513039 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT517888 SSTR2 somatostatin receptor 2 2 2
MIRT520420 TXNL1 thioredoxin like 1 2 6
MIRT521826 POLR1D RNA polymerase I subunit D 2 2
MIRT534072 SRPK1 SRSF protein kinase 1 2 2
MIRT534240 SLC23A1 solute carrier family 23 member 1 2 2
MIRT538794 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT538980 BCL2L2 BCL2 like 2 2 2
MIRT542111 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 4
MIRT546462 SLC39A14 solute carrier family 39 member 14 2 2
MIRT552217 SSPN sarcospan 2 2
MIRT552224 NDUFS1 NADH:ubiquinone oxidoreductase core subunit S1 2 2
MIRT554420 SATB2 SATB homeobox 2 2 2
MIRT555385 PPP1CC protein phosphatase 1 catalytic subunit gamma 2 2
MIRT569625 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT573895 MKI67 marker of proliferation Ki-67 2 2
MIRT575161 Fam120c family with sequence similarity 120, member C 2 2
MIRT607347 YAE1D1 Yae1 domain containing 1 2 6
MIRT607413 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT608320 SYK spleen associated tyrosine kinase 2 4
MIRT608473 RRP36 ribosomal RNA processing 36 2 2
MIRT608523 TMOD3 tropomodulin 3 2 4
MIRT608572 RNF149 ring finger protein 149 2 2
MIRT608609 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT608676 STPG1 sperm tail PG-rich repeat containing 1 2 2
MIRT608724 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT610392 FOXE1 forkhead box E1 2 2
MIRT610537 FAM46A family with sequence similarity 46 member A 2 4
MIRT610664 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT611258 EHD3 EH domain containing 3 2 2
MIRT612247 MICALL1 MICAL like 1 2 2
MIRT613500 ZNF488 zinc finger protein 488 2 2
MIRT613790 RPS6 ribosomal protein S6 2 2
MIRT613832 SPIRE2 spire type actin nucleation factor 2 2 2
MIRT614357 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT614539 NOA1 nitric oxide associated 1 2 2
MIRT615947 SORD sorbitol dehydrogenase 2 2
MIRT616144 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT617103 MPPE1 metallophosphoesterase 1 2 2
MIRT617383 FAM227A family with sequence similarity 227 member A 2 2
MIRT618126 LACTB lactamase beta 2 4
MIRT618236 PGBD4 piggyBac transposable element derived 4 2 2
MIRT618262 DDX51 DEAD-box helicase 51 2 2
MIRT618286 ZNF682 zinc finger protein 682 2 4
MIRT618316 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT618678 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT619206 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT619658 CORO2A coronin 2A 2 2
MIRT619726 FPR2 formyl peptide receptor 2 2 2
MIRT619870 ZNF347 zinc finger protein 347 2 2
MIRT620129 ZNF283 zinc finger protein 283 2 2
MIRT621087 WDR12 WD repeat domain 12 2 2
MIRT621114 SP110 SP110 nuclear body protein 2 2
MIRT621129 EMC7 ER membrane protein complex subunit 7 2 4
MIRT621236 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT621421 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT621576 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT621689 TSPYL1 TSPY like 1 2 2
MIRT621794 TMEM233 transmembrane protein 233 2 2
MIRT621929 SYAP1 synapse associated protein 1 2 4
MIRT621965 STRIP2 striatin interacting protein 2 2 2
MIRT622102 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT622184 SLC7A14 solute carrier family 7 member 14 2 2
MIRT622238 SLC25A45 solute carrier family 25 member 45 2 2
MIRT622473 RNF11 ring finger protein 11 2 2
MIRT622514 RBM20 RNA binding motif protein 20 2 2
MIRT622523 RAD51 RAD51 recombinase 2 2
MIRT622665 POLQ DNA polymerase theta 2 4
MIRT622699 PLEKHO1 pleckstrin homology domain containing O1 2 2
MIRT622831 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT622873 PDE12 phosphodiesterase 12 2 2
MIRT623031 OCIAD2 OCIA domain containing 2 2 2
MIRT623083 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623303 MARCH7 membrane associated ring-CH-type finger 7 2 2
MIRT623932 FKBP14 FK506 binding protein 14 2 2
MIRT624060 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT624295 COMMD2 COMM domain containing 2 2 2
MIRT624521 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT624824 ACO1 aconitase 1 2 2
MIRT624908 CTCFL CCCTC-binding factor like 2 2
MIRT625154 ZCCHC8 zinc finger CCHC-type containing 8 2 4
MIRT625382 ZNF716 zinc finger protein 716 2 2
MIRT625771 RBM3 RNA binding motif (RNP1, RRM) protein 3 2 4
MIRT625808 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT625835 NXPE2 neurexophilin and PC-esterase domain family member 2 2 2
MIRT626010 ZNF517 zinc finger protein 517 2 2
MIRT626058 AP3M1 adaptor related protein complex 3 mu 1 subunit 2 2
MIRT626116 IL23R interleukin 23 receptor 2 2
MIRT626252 RBM43 RNA binding motif protein 43 2 2
MIRT626350 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT626888 ANGEL1 angel homolog 1 2 2
MIRT627303 WDR31 WD repeat domain 31 2 2
MIRT627597 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT627618 SF3B1 splicing factor 3b subunit 1 2 2
MIRT627630 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT627642 SEC23IP SEC23 interacting protein 2 2
MIRT627651 SAR1A secretion associated Ras related GTPase 1A 2 4
MIRT628388 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628675 C2orf72 chromosome 2 open reading frame 72 2 2
MIRT628780 TMEM154 transmembrane protein 154 2 2
MIRT629181 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT629266 NXPE1 neurexophilin and PC-esterase domain family member 1 2 2
MIRT629307 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT629322 ZNF487P zinc finger protein 487 1 1
MIRT629524 ZNF37A zinc finger protein 37A 2 2
MIRT629611 NOL10 nucleolar protein 10 2 2
MIRT629659 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT629671 USP1 ubiquitin specific peptidase 1 2 2
MIRT629765 STK25 serine/threonine kinase 25 2 2
MIRT630447 IDE insulin degrading enzyme 2 2
MIRT630903 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT631001 ZNF573 zinc finger protein 573 2 2
MIRT631157 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT631178 HCAR1 hydroxycarboxylic acid receptor 1 2 2
MIRT631339 ZNF84 zinc finger protein 84 2 2
MIRT631342 LATS1 large tumor suppressor kinase 1 2 2
MIRT631359 ZFP30 ZFP30 zinc finger protein 2 4
MIRT631461 FBXO47 F-box protein 47 2 2
MIRT631585 ITGAL integrin subunit alpha L 2 2
MIRT631597 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT631643 WDR91 WD repeat domain 91 2 4
MIRT631781 IL17RA interleukin 17 receptor A 2 2
MIRT631858 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT632040 ZNF430 zinc finger protein 430 2 2
MIRT632094 SSR1 signal sequence receptor subunit 1 2 2
MIRT632153 CWC25 CWC25 spliceosome associated protein homolog 2 2
MIRT632234 VTA1 vesicle trafficking 1 2 2
MIRT632287 TTPAL alpha tocopherol transfer protein like 2 2
MIRT632328 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT632392 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT632412 SLC30A5 solute carrier family 30 member 5 2 2
MIRT632557 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT633066 DENND5B DENN domain containing 5B 2 2
MIRT633185 AAK1 AP2 associated kinase 1 2 2
MIRT633196 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT633220 ZNF584 zinc finger protein 584 2 2
MIRT633343 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT633407 ZNF566 zinc finger protein 566 2 2
MIRT633479 ZNF724P zinc finger protein 724 2 2
MIRT633485 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT633516 LRRC27 leucine rich repeat containing 27 2 2
MIRT633556 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT633659 SLC28A1 solute carrier family 28 member 1 2 2
MIRT633681 ZNF576 zinc finger protein 576 2 2
MIRT633758 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633771 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633776 F2 coagulation factor II, thrombin 2 2
MIRT633803 ZNF91 zinc finger protein 91 2 2
MIRT633813 WDR92 WD repeat domain 92 2 2
MIRT633948 TMEM231 transmembrane protein 231 2 2
MIRT634000 RTN2 reticulon 2 2 2
MIRT634024 MOB4 MOB family member 4, phocein 2 2
MIRT634228 TMEM132B transmembrane protein 132B 2 2
MIRT634320 SLC43A2 solute carrier family 43 member 2 2 2
MIRT634355 RNF157 ring finger protein 157 2 2
MIRT634586 KIAA1958 KIAA1958 2 2
MIRT634748 CRCP CGRP receptor component 2 2
MIRT635409 KIAA1614 KIAA1614 2 2
MIRT635461 GBP4 guanylate binding protein 4 2 2
MIRT635501 CCR4 C-C motif chemokine receptor 4 2 2
MIRT635627 CDT1 chromatin licensing and DNA replication factor 1 2 4
MIRT635646 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT635750 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 2 2
MIRT635824 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT635969 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT636121 YPEL1 yippee like 1 2 2
MIRT636171 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636194 TCEB1 elongin C 2 2
MIRT636772 CLUAP1 clusterin associated protein 1 2 2
MIRT636799 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT636955 APTX aprataxin 2 2
MIRT637096 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637149 PCDHA6 protocadherin alpha 6 2 2
MIRT637207 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637321 FAM9B family with sequence similarity 9 member B 2 2
MIRT637544 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637632 ZNF431 zinc finger protein 431 2 2
MIRT637658 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637704 ZNF439 zinc finger protein 439 2 2
MIRT637807 GGPS1 geranylgeranyl diphosphate synthase 1 2 2
MIRT637831 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT637907 FAM153B family with sequence similarity 153 member B 2 4
MIRT637953 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT637974 IRF1 interferon regulatory factor 1 2 2
MIRT638026 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT638066 KCNN1 potassium calcium-activated channel subfamily N member 1 2 2
MIRT638197 TAOK1 TAO kinase 1 2 2
MIRT638403 PRR11 proline rich 11 2 2
MIRT638625 GSR glutathione-disulfide reductase 2 4
MIRT638651 GK5 glycerol kinase 5 (putative) 2 2
MIRT638993 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT639000 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT642200 SMAGP small cell adhesion glycoprotein 2 2
MIRT642537 CERS4 ceramide synthase 4 2 2
MIRT643021 LETM2 leucine zipper and EF-hand containing transmembrane protein 2 2 2
MIRT643423 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643459 LAX1 lymphocyte transmembrane adaptor 1 2 4
MIRT643766 NAGK N-acetylglucosamine kinase 2 2
MIRT643892 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT644097 SIAH3 siah E3 ubiquitin protein ligase family member 3 2 2
MIRT644680 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644710 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT644726 SEPT14 septin 14 2 2
MIRT645138 HES2 hes family bHLH transcription factor 2 2 2
MIRT645314 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645561 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT645737 POLR3A RNA polymerase III subunit A 2 2
MIRT646042 NPR1 natriuretic peptide receptor 1 2 2
MIRT646150 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT646362 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT646566 ALDH5A1 aldehyde dehydrogenase 5 family member A1 2 2
MIRT646871 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT647022 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT647104 GNL3L G protein nucleolar 3 like 2 2
MIRT647363 WDR5B WD repeat domain 5B 2 2
MIRT648059 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648088 FAM192A family with sequence similarity 192 member A 2 2
MIRT648152 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT648432 MYOZ3 myozenin 3 2 2
MIRT648451 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT648920 ZNF551 zinc finger protein 551 2 2
MIRT649104 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT649109 RPL37 ribosomal protein L37 2 2
MIRT649259 IMPA2 inositol monophosphatase 2 2 2
MIRT649742 GNB5 G protein subunit beta 5 2 2
MIRT650092 TERF2 telomeric repeat binding factor 2 2 2
MIRT650578 TTR transthyretin 2 2
MIRT650739 FKTN fukutin 2 2
MIRT650871 APOH apolipoprotein H 2 2
MIRT651024 ZNF699 zinc finger protein 699 2 2
MIRT651391 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651526 WNT2B Wnt family member 2B 2 2
MIRT652640 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT653261 SOGA3 SOGA family member 3 2 2
MIRT653285 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT653526 SLC38A9 solute carrier family 38 member 9 2 2
MIRT653708 SLC25A33 solute carrier family 25 member 33 2 2
MIRT653826 SHROOM4 shroom family member 4 2 2
MIRT653888 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT654217 RNF19B ring finger protein 19B 2 2
MIRT654848 PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K 2 2
MIRT655370 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT655520 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT656962 KIAA0408 KIAA0408 2 2
MIRT657048 KCNH6 potassium voltage-gated channel subfamily H member 6 2 2
MIRT657113 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT657198 IKZF3 IKAROS family zinc finger 3 2 2
MIRT657269 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT657317 HOOK3 hook microtubule tethering protein 3 2 2
MIRT657365 HMGB1 high mobility group box 1 2 2
MIRT657522 GTF2H5 general transcription factor IIH subunit 5 2 4
MIRT657535 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT659037 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659590 CEP135 centrosomal protein 135 2 2
MIRT659801 CAV2 caveolin 2 2 2
MIRT659947 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT660693 ANAPC1 anaphase promoting complex subunit 1 2 4
MIRT660951 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT660989 ABHD2 abhydrolase domain containing 2 2 2
MIRT661410 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 2 2
MIRT661524 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT661752 ATM ATM serine/threonine kinase 2 2
MIRT662158 ALDH7A1 aldehyde dehydrogenase 7 family member A1 2 2
MIRT663363 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT663513 AGMO alkylglycerol monooxygenase 2 2
MIRT663533 ZNF70 zinc finger protein 70 2 2
MIRT663633 HM13 histocompatibility minor 13 2 2
MIRT663760 ZNF285 zinc finger protein 285 2 2
MIRT663841 TRIM72 tripartite motif containing 72 2 2
MIRT664024 C9orf139 chromosome 9 open reading frame 139 2 2
MIRT664049 ANKRD62 ankyrin repeat domain 62 2 2
MIRT664118 C4orf32 family with sequence similarity 241 member A 2 2
MIRT664280 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT664642 GALM galactose mutarotase 2 2
MIRT664685 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT664764 MESDC2 mesoderm development LRP chaperone 2 2
MIRT665281 ZFP14 ZFP14 zinc finger protein 2 2
MIRT665874 TGOLN2 trans-golgi network protein 2 2 2
MIRT666194 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666416 SH3D19 SH3 domain containing 19 2 2
MIRT666917 POC1A POC1 centriolar protein A 2 2
MIRT666946 PLSCR1 phospholipid scramblase 1 2 2
MIRT667064 PAOX polyamine oxidase 2 2
MIRT667090 OSTF1 osteoclast stimulating factor 1 2 2
MIRT667677 KPNA6 karyopherin subunit alpha 6 2 2
MIRT667790 KARS lysyl-tRNA synthetase 2 2
MIRT668268 FOXO3 forkhead box O3 2 2
MIRT668555 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT668830 CYCS cytochrome c, somatic 2 2
MIRT669087 CDX2 caudal type homeobox 2 2 2
MIRT669397 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT669571 AKIRIN1 akirin 1 2 2
MIRT669761 ZNF101 zinc finger protein 101 2 2
MIRT669802 GAN gigaxonin 2 2
MIRT669811 STOML1 stomatin like 1 2 2
MIRT669869 MELK maternal embryonic leucine zipper kinase 2 2
MIRT669928 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT669952 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT670052 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670100 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT670302 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670391 EMP2 epithelial membrane protein 2 2 2
MIRT670487 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670537 KIF1C kinesin family member 1C 2 2
MIRT670608 NPHP1 nephrocystin 1 2 2
MIRT670789 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT670885 CYTIP cytohesin 1 interacting protein 2 2
MIRT670936 LIPG lipase G, endothelial type 2 2
MIRT671267 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671307 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671518 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 2
MIRT671628 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT671683 ADK adenosine kinase 2 2
MIRT671786 RGS17 regulator of G protein signaling 17 2 2
MIRT671811 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT672006 SLC35F6 solute carrier family 35 member F6 2 4
MIRT672106 TLCD2 TLC domain containing 2 2 2
MIRT672238 ABHD15 abhydrolase domain containing 15 2 2
MIRT672274 SHE Src homology 2 domain containing E 2 2
MIRT672325 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT672696 ZNF677 zinc finger protein 677 2 2
MIRT672817 VEZT vezatin, adherens junctions transmembrane protein 2 2
MIRT672863 C22orf29 retrotransposon Gag like 10 2 2
MIRT672891 FXN frataxin 2 2
MIRT672980 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT673256 INO80 INO80 complex subunit 2 2
MIRT673400 WNT7B Wnt family member 7B 2 2
MIRT673527 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT673544 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674004 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674018 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT674249 NUP62 nucleoporin 62 2 4
MIRT674358 SLC35E3 solute carrier family 35 member E3 2 2
MIRT674708 FAM73A mitoguardin 1 2 2
MIRT674911 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT675200 ZNF554 zinc finger protein 554 2 2
MIRT675295 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT675374 DCTN5 dynactin subunit 5 2 2
MIRT675446 TPCN2 two pore segment channel 2 2 2
MIRT675473 NUBPL nucleotide binding protein like 2 2
MIRT675672 TMOD2 tropomodulin 2 2 2
MIRT675684 SLC35F5 solute carrier family 35 member F5 2 2
MIRT675789 MED28 mediator complex subunit 28 2 2
MIRT675834 DHODH dihydroorotate dehydrogenase (quinone) 2 4
MIRT675979 FAM126B family with sequence similarity 126 member B 2 2
MIRT676090 DPP9 dipeptidyl peptidase 9 2 2
MIRT676100 ZNF667 zinc finger protein 667 2 2
MIRT676132 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT676171 HIST1H2BJ histone cluster 1 H2B family member j 2 2
MIRT676243 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676293 SLC25A37 solute carrier family 25 member 37 2 2
MIRT676310 GTF2H2C GTF2H2 family member C 2 2
MIRT676341 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT676389 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676441 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676520 RNF216 ring finger protein 216 2 2
MIRT676584 RDH13 retinol dehydrogenase 13 2 4
MIRT676611 KDSR 3-ketodihydrosphingosine reductase 2 2
MIRT676692 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT676699 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT676745 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT676765 SNX2 sorting nexin 2 2 2
MIRT676778 NPHS1 NPHS1, nephrin 2 2
MIRT676799 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT676859 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT676881 ENSA endosulfine alpha 2 2
MIRT676948 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT676962 HFE hemochromatosis 2 2
MIRT677010 HINFP histone H4 transcription factor 2 2
MIRT677049 ZNF34 zinc finger protein 34 2 2
MIRT677075 VMAC vimentin type intermediate filament associated coiled-coil protein 2 2
MIRT677097 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677130 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 2 2
MIRT677170 ZNF786 zinc finger protein 786 2 2
MIRT677219 RASSF6 Ras association domain family member 6 2 2
MIRT677238 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677408 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT677428 DDX19B DEAD-box helicase 19B 2 2
MIRT677436 NSMCE2 NSE2/MMS21 homolog, SMC5-SMC6 complex SUMO ligase 2 2
MIRT677467 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677489 GTF2H2 general transcription factor IIH subunit 2 2 2
MIRT677555 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677583 TRIM65 tripartite motif containing 65 2 2
MIRT677602 PRKX protein kinase, X-linked 2 2
MIRT677650 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677702 GINS2 GINS complex subunit 2 2 2
MIRT677764 GRM6 glutamate metabotropic receptor 6 2 2
MIRT677788 CEACAM5 carcinoembryonic antigen related cell adhesion molecule 5 2 2
MIRT677814 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT677891 DCP1A decapping mRNA 1A 2 2
MIRT677921 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT677944 ZNF519 zinc finger protein 519 2 2
MIRT677989 GATC glutamyl-tRNA amidotransferase subunit C 2 2
MIRT678015 SPIC Spi-C transcription factor 2 2
MIRT678068 UBN2 ubinuclein 2 2 2
MIRT678084 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678128 METTL21A methyltransferase like 21A 2 2
MIRT678147 SLC4A4 solute carrier family 4 member 4 2 2
MIRT678156 IRGQ immunity related GTPase Q 2 2
MIRT678224 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT678327 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678357 PPAP2B phospholipid phosphatase 3 2 2
MIRT678401 MYPN myopalladin 2 2
MIRT678421 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678434 PDE4C phosphodiesterase 4C 2 2
MIRT678444 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT678493 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT678507 LCTL lactase like 2 2
MIRT678526 P2RX7 purinergic receptor P2X 7 2 2
MIRT678534 TMEM78 transmembrane protein 78 2 2
MIRT678570 CDK4 cyclin dependent kinase 4 2 2
MIRT678608 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT678642 PDCD4 programmed cell death 4 2 2
MIRT678702 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT678724 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678764 CEP76 centrosomal protein 76 2 2
MIRT678814 HRH4 histamine receptor H4 2 2
MIRT678880 FAM118A family with sequence similarity 118 member A 2 2
MIRT678905 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT678946 MYADM myeloid associated differentiation marker 2 2
MIRT678960 ZNF329 zinc finger protein 329 2 2
MIRT678972 OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 2 2
MIRT679067 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT679072 MANEAL mannosidase endo-alpha like 2 2
MIRT679084 PURB purine rich element binding protein B 2 2
MIRT679115 NMNAT1 nicotinamide nucleotide adenylyltransferase 1 2 2
MIRT679155 ZDHHC15 zinc finger DHHC-type containing 15 2 2
MIRT679177 FFAR4 free fatty acid receptor 4 2 2
MIRT679183 XIAP X-linked inhibitor of apoptosis 2 4
MIRT679224 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679234 LRP10 LDL receptor related protein 10 2 2
MIRT679271 POLM DNA polymerase mu 2 2
MIRT679279 MIPOL1 mirror-image polydactyly 1 2 2
MIRT679345 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT679352 LRG1 leucine rich alpha-2-glycoprotein 1 2 2
MIRT679365 SIK2 salt inducible kinase 2 2 2
MIRT679493 ZNF106 zinc finger protein 106 2 2
MIRT679600 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT679636 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT679650 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT679713 RPL24 ribosomal protein L24 2 2
MIRT679762 TLR6 toll like receptor 6 2 2
MIRT679766 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT679807 APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A 2 2
MIRT679821 TMEM106B transmembrane protein 106B 2 2
MIRT679949 AS3MT arsenite methyltransferase 2 2
MIRT679967 FGFR1OP FGFR1 oncogene partner 2 2
MIRT679992 RUNDC1 RUN domain containing 1 2 2
MIRT680063 CD96 CD96 molecule 2 2
MIRT680079 THAP1 THAP domain containing 1 2 2
MIRT680100 PXMP4 peroxisomal membrane protein 4 2 2
MIRT680138 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT680146 TOP3A DNA topoisomerase III alpha 2 2
MIRT680324 LRRC58 leucine rich repeat containing 58 2 2
MIRT680414 RNF165 ring finger protein 165 2 2
MIRT680451 PDE6A phosphodiesterase 6A 2 2
MIRT680460 TAS2R5 taste 2 receptor member 5 2 2
MIRT683249 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT685083 HPSE heparanase 2 2
MIRT686255 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT687366 NUP155 nucleoporin 155 2 2
MIRT688320 FAM151B family with sequence similarity 151 member B 2 2
MIRT688390 ENAH ENAH, actin regulator 2 2
MIRT688430 DNAL1 dynein axonemal light chain 1 2 2
MIRT688643 CREM cAMP responsive element modulator 2 2
MIRT688739 CNDP1 carnosine dipeptidase 1 2 2
MIRT689335 FPR1 formyl peptide receptor 1 2 4
MIRT690685 PTCHD3 patched domain containing 3 2 2
MIRT690956 APOL1 apolipoprotein L1 2 2
MIRT691727 LARS leucyl-tRNA synthetase 2 2
MIRT693472 ZNF707 zinc finger protein 707 2 2
MIRT693959 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT695487 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT696596 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT697024 EPDR1 ependymin related 1 2 2
MIRT698140 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT699106 SNIP1 Smad nuclear interacting protein 1 2 2
MIRT699817 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT701535 NCKAP1 NCK associated protein 1 2 2
MIRT702897 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT705035 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT706023 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706039 F2R coagulation factor II thrombin receptor 2 2
MIRT706102 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706311 CCDC30 coiled-coil domain containing 30 2 2
MIRT706345 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT706400 HAS2 hyaluronan synthase 2 2 2
MIRT706436 LIAS lipoic acid synthetase 2 2
MIRT709396 QRFPR pyroglutamylated RFamide peptide receptor 2 2
MIRT710345 ZNF669 zinc finger protein 669 2 2
MIRT710725 C19orf68 zinc finger SWIM-type containing 9 2 2
MIRT711276 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 2 2
MIRT711862 TRAF2 TNF receptor associated factor 2 2 2
MIRT711921 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT712060 ZBTB34 zinc finger and BTB domain containing 34 2 2
MIRT712593 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT712903 TGFA transforming growth factor alpha 2 2
MIRT713297 DCP2 decapping mRNA 2 2 2
MIRT714801 WDPCP WD repeat containing planar cell polarity effector 2 2
MIRT715314 POLR2E RNA polymerase II subunit E 2 2
MIRT715727 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT717606 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT717877 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT718484 TMEM151A transmembrane protein 151A 2 2
MIRT720439 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT721563 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT721698 TFAP2B transcription factor AP-2 beta 2 2
MIRT722525 PLXNA2 plexin A2 2 2
MIRT722758 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723297 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT723407 NLRP10 NLR family pyrin domain containing 10 2 2
MIRT724218 RAB6B RAB6B, member RAS oncogene family 2 2
MIRT724422 FGF2 fibroblast growth factor 2 2 2
MIRT756017 AMBRA1 autophagy and beclin 1 regulator 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3653 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-3653 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3653 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3653 Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-3653 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-3653 Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-3653 Platinum 23939 resistant tissue
hsa-miR-3653 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3653 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3653-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-3653-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission