pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6787 |
Genomic Coordinates | chr17: 82236668 - 82236728 |
Description | Homo sapiens miR-6787 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6787-5p | ||||||||||||||||||||||||||||||||||||
Sequence | 6| UGGCGGGGGUAGAGCUGGCUGC |27 | ||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NEUROD2 | ||||||||||||||||||||
Synonyms | NDRF, bHLHa1 | ||||||||||||||||||||
Description | neuronal differentiation 2 | ||||||||||||||||||||
Transcript | NM_006160 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NEUROD2 | |||||||||||||||||||||
3'UTR of NEUROD2 (miRNA target sites are highlighted) |
>NEUROD2|NM_006160|3'UTR 1 GACTTCGCGCCGGCTCCCTTCTTTTTCTTTTGCCTTTGCCCGCCCCCCTGTCCCCAGCCCCCAGAGCGCAGGGACACCCC 81 CATCCTACCCCGGCGCCGGGCGCGGGGAGCGGGCCACCGGTCCTGCCGCTCTCCTGGGGCAGCGCAGTCCTGTTACCTGT 161 GGGTGGCCTGTCCCAGGGGCCTCGCTTCCCCCAGGGGACTCGCCTTCTCTCTCCCCAAGGGGTTCCCTCCTCCTCTCTCC 241 CAAGGAGTGCTTCTCCAGGGACCTCTCTCCGGGGGCTCCCTGGAGGCACCCCTCCCCCATTCCCAATATCTTCGCTGAGG 321 TTTCCTCCTCCCCCTCCTCCCTGCAGGCCCAAGGCGTTGGTAAGGGGGCAGCTGAGCAATGGAACGCGTTTCCCCCTCTC 401 ATTATTATTTTAAAAACAGACACCCAGCTGCCGAGGCAAAAAGGAGCCAGGCGCTCCCTCTTTCTTGAAGAGGGTAGAAG 481 TTAGGGCGCCGGAGCCCGGGCCTGGAACGCCCTCACCCCCAACCTCCAGTCTCCGCGTTTTGCGATTTTAATTTTGGCGG 561 GAGGGGAAGTGGATTGAGAGGAAAGAGAGAGGCCAAGACAATTTGTAACTAGAATCCGTTTTTCCCTTTTCCTTTTTTTA 641 AACAAACAAACATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCTAAGAGGCGACGGAAGCCGAACG 721 CAGAGTCCGGATCGGAGAGAAAACGCAGTAAGGACTTTTAGAAGCAATAAAAGGCAAAAAAAACAAAAAACAAAAAAACA 801 AACAAAAAAAAACCACTACTACCAATAATCAAAGACACAAATATCTATGCAAGGAGGCTCCACTGAGCCTCGCGGCCCGG 881 CCCGGCCCCGGGATGCCCCGCCCGGCCTGCGGGCCGCCCCGCCCGAGCGCGGATCTGTGCACTTTGGTGAAGTGGGGGCC 961 CGCGCCGCCCCCTCCCCCTCCCCAGGTTCTTACAATCAGTGACTCGGAGATTTGGGGCCCCAGTGCCACTGCCCTCCCCC 1041 GCCCCGTCCCCGTTGTGCGTCATGCTGTTTTTTAAAAACCTGTTTCCAAATTTGTATGGAATGGCAAACTGTTGGGGGGT 1121 CGGTTTGGGGAGGGAGGGTTTGCATGAAAGACACACGCACACCACACCGCACGCACAAGCAGGCCCGGCGCCGGCGTCCG 1201 GGGGGCAGAAGGAGGTGAGCTCGCCGGCTCCTCCTCCCCGCGGCCATTCTGTCCCCTCCTGGGGTGAGGGGTGGGGATGG 1281 AGACCTGGGGGCAGCCCCACCCCTGCCCGGACTGTGCCTCGGTGGGTGCCACCTGGCGATTTCCGGTGTCTGGAGAGAGT 1361 ATTTTTTGGTCCAAGGAGTCCTCTTGGCTTTAGCTGGTGGGTGGGCGGGGAGAGGTCTGAGGGCTCCTACTGGAGGTTCC 1441 CCCAAAAAGGGGCAAAAGGAGACCCTCTGCCCACCGGAGGCAGGGGATCAGGCATCCAAATACACGATGCAAAAATGCAA 1521 TCCCACAGGCGACACACCCACACACTCACCCACACACACGCAATTTTACCTTCCTCTTGTAGCGAAGATGAAACTCCCGT 1601 CGGACACCCGAAGTGCATTGCGTGTTTCTGTTCAGTTTAATGACGATTAATAAATATTTATGTAAATGAGATGCAAAGCC 1681 GGAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C8166 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000302584.4 | 3UTR | CCGGGAUGCCCCGCCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000302584.4 | 3UTR | CCGGGAUGCCCCGCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000302584.4 | 3UTR | CCGGGAUGCCCCGCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000302584.4 | 3UTR | ACUGCCCUCCCCCGCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT449091 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449991 | PSMG1 | proteasome assembly chaperone 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454608 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 2 | ||||||
MIRT456116 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT457064 | TOR4A | torsin family 4 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT461023 | SDF4 | stromal cell derived factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467197 | SPRY4 | sprouty RTK signaling antagonist 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471711 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472566 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476079 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480150 | CALR | calreticulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT483027 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483498 | STMN3 | stathmin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483728 | THSD4 | thrombospondin type 1 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484550 | BARHL1 | BarH like homeobox 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484684 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486059 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486116 | INO80E | INO80 complex subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT486313 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486525 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486857 | DPF1 | double PHD fingers 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487352 | PHF15 | jade family PHD finger 2 | ![]() |
1 | 1 | |||||||
MIRT487582 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 4 | ||||||
MIRT487792 | GPR20 | G protein-coupled receptor 20 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488104 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488786 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489361 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489387 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489680 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489731 | GNAI2 | G protein subunit alpha i2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489750 | TACC3 | transforming acidic coiled-coil containing protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490029 | PCSK4 | proprotein convertase subtilisin/kexin type 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490379 | LHFPL3 | LHFPL tetraspan subfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490580 | SLC47A1 | solute carrier family 47 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490753 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491187 | JUND | JunD proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491301 | VGF | VGF nerve growth factor inducible | ![]() |
![]() |
2 | 2 | ||||||
MIRT491462 | HOXB8 | homeobox B8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491702 | PDZD4 | PDZ domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491724 | RTN4R | reticulon 4 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT491737 | SEMA3F | semaphorin 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT491984 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492844 | NRGN | neurogranin | ![]() |
![]() |
2 | 2 | ||||||
MIRT492936 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT493713 | H2AFX | H2A histone family member X | ![]() |
![]() |
2 | 2 | ||||||
MIRT494623 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494703 | ARHGAP31 | Rho GTPase activating protein 31 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495602 | NKX2-5 | NK2 homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495750 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 4 | ||||||
MIRT500367 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT501161 | SLC10A7 | solute carrier family 10 member 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT501702 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504922 | PDRG1 | p53 and DNA damage regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517945 | TRIM59 | tripartite motif containing 59 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524212 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT531186 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT531972 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558055 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT560482 | LACE1 | AFG1 like ATPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563217 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569095 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569522 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT569531 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569848 | RGS5 | regulator of G protein signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570738 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574140 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615994 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628493 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633451 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT649054 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649340 | HEXA | hexosaminidase subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT670226 | PTCHD1 | patched domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670666 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671452 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671729 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690285 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700575 | PRSS22 | protease, serine 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701411 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT711877 | VASP | vasodilator stimulated phosphoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT712082 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712523 | CYTH2 | cytohesin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712751 | GMDS | GDP-mannose 4,6-dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT714681 | PRX | periaxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT714718 | VPS8 | VPS8, CORVET complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT717508 | HRNR | hornerin | ![]() |
![]() |
2 | 2 | ||||||
MIRT717650 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719592 | PIAS4 | protein inhibitor of activated STAT 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720521 | PTGR2 | prostaglandin reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721295 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724922 | VPS18 | VPS18, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|