pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1185-1 |
Genomic Coordinates | chr14: 101042977 - 101043062 |
Synonyms | MIRN1185-1, hsa-mir-1185-1, MIR1185-1 |
Description | Homo sapiens miR-1185-1 stem-loop |
Comment | This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1185-1-3p | ||||||||||||||||||||||||||||||
Sequence | 53| AUAUACAGGGGGAGACUCUUAU |74 | ||||||||||||||||||||||||||||||
Evidence | Not_experimental | ||||||||||||||||||||||||||||||
Experiments | |||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MTFR1 | ||||||||||||||||||||
Synonyms | CHPPR, FAM54A2 | ||||||||||||||||||||
Description | mitochondrial fission regulator 1 | ||||||||||||||||||||
Transcript | NM_001145838 | ||||||||||||||||||||
Other Transcripts | NM_001145839 , NM_014637 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MTFR1 | |||||||||||||||||||||
3'UTR of MTFR1 (miRNA target sites are highlighted) |
>MTFR1|NM_001145838|3'UTR 1 TAGACAATGAGCTGCGAAAAGACTCCTGGTTCCCCTGTTGATTTGTGAGGGCCAAGTTTGCTAGTAGAAATCGACACTGT 81 TTAGTAAATACCTCTTTAGTATTCAGTGGTCTTCTTTTCAGGCTAATTAGTGGATTAAGCAATAATGAAAGCACTAAGTT 161 TGGTTTTGCTTTTGTGAGATGGTCAGCTTTGGTGCTCTCCACAACATGTGTGTTCTGACATGTTTCTAATATGTGGCCAG 241 GGCGTTCAGATTTCCAGTTTTGAAAACAATTGTATAGATTTCACAACACAAAAAGGACATTTGTGGATGTTACTGCACAT 321 TTTAAATTCTTAACACTAATTTATCTGTATAAGTGTTTTATATGCATATTTTTGGACATAAACAGTTTATGTAAAATTAG 401 TAATGAATGATGGCAACGAGGGCACTGTTATCTTCGTTTGTTTTCAATGATCATTTAGCATTCAATGATGGAACAGCTGG 481 TATAACATAAGTTGTTGGCATGAAATATTTGAGATTGGAAACTTCTTGCCTTGAACAGAACTTATATCTTAGATTCTCTC 561 TCACATTTTCTTGGAGCTGGGGTTTGAATAGGAACCAGATGATGTTCACTGCTGAAATTCCATAATGCTTCCCATTGAAG 641 GGAAGTTGAGAACCAGGAAAGCTGCTTTCACGTCATTGCCATCCAGTACTGACAGGGAAGAAAGATGTAGTTTTCCAGTA 721 GTGATGAATCAAATTATTGAATTAAATTTCTTCTTAAGAAGTAAAAACTCAGAATGTACCATCTTGTTTCCTTTCAGTTT 801 ATTAAATGGCATCATAAAGATGACTTTGCTAAGTTAATAGAGTTAAAAATTTTTTTAATATAAGCCAAAATATTAACTTT 881 AATGAAACATTGACTTGGCAAATGAATTTCCTATAAATTATCATTGGTCAGAATGCTGTTTTGTTTAATAATATTACGCA 961 ACATAAACCATAGGTGTTATTAGAAGTGGAGAACTGCCTTTTTCATCTGGGGCTTTTAAGGACTTGCTATAAATGATTAT 1041 TTTTTAAATGCTTTATAAATCTTCATGGTTTTTCTATTTCTGATACACTCAGCTATAGTTAATACCAGAGTATCCTACCA 1121 GGAGTAATATTTGGAATATTTAAATCTAGTAAAAGAAGAAAGTTGTACTTCCTGGCTGGGAGTATTAGGAGATGGGAGTA 1201 GAGATTCACTTTTAAGTTCTTGAAAATATATGCATTCTCCTAAATATTAACAAAAATGATTTGGGGAAATGACATGGCTT 1281 GATTGTTCTGTTTAAATTTGTACTGTGGCTTATGTTACACATGTTCATGTTCACCTCTCATTCACCTGTTTTATATGGTT 1361 TAAAATTCTCTTTAACAAAATTCAGAAAATTCACCTGAAACGTATTTTGACCTAAAAGAAACATATTTTTGTATCAGTAT 1441 TGAATTTTGGACAGTGCCCCCATATAAGGAAGTTACTGTTTTAAAATAAAGCAAACTAACTGTTTTATTTTCCTTGGACA 1521 AAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C8166 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000458689.2 | 3UTR | CACAUUUUAAAUUCUUAACACUAAUUUAUCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
114 hsa-miR-1185-1-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066415 | TBK1 | TANK binding kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT073567 | NR2F2 | nuclear receptor subfamily 2 group F member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074516 | USP1 | ubiquitin specific peptidase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT080576 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT086539 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT086547 | MOB4 | MOB family member 4, phocein | ![]() |
![]() |
2 | 2 | ||||||
MIRT088684 | EML4 | echinoderm microtubule associated protein like 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT090811 | MBNL1 | muscleblind like splicing regulator 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT095500 | PURA | purine rich element binding protein A | ![]() |
![]() |
2 | 2 | ||||||
MIRT109530 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT109807 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT117888 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT120273 | GSK3B | glycogen synthase kinase 3 beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT149892 | LDLR | low density lipoprotein receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT178475 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 4 | ||||||
MIRT193445 | RORA | RAR related orphan receptor A | ![]() |
![]() |
2 | 2 | ||||||
MIRT198527 | DSG2 | desmoglein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT226427 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT227669 | SET | SET nuclear proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT320405 | HOXA9 | homeobox A9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407774 | MRPL35 | mitochondrial ribosomal protein L35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT439228 | ZMIZ1 | zinc finger MIZ-type containing 1 | ![]() |
1 | 1 | |||||||
MIRT439312 | VAT1L | vesicle amine transport 1 like | ![]() |
1 | 1 | |||||||
MIRT439421 | TMOD1 | tropomodulin 1 | ![]() |
1 | 1 | |||||||
MIRT439446 | TMEM104 | transmembrane protein 104 | ![]() |
1 | 1 | |||||||
MIRT439524 | STIM2 | stromal interaction molecule 2 | ![]() |
1 | 1 | |||||||
MIRT439612 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | ![]() |
1 | 1 | |||||||
MIRT439997 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | ![]() |
1 | 1 | |||||||
MIRT440017 | PCSK1 | proprotein convertase subtilisin/kexin type 1 | ![]() |
1 | 1 | |||||||
MIRT440131 | NCOA4 | nuclear receptor coactivator 4 | ![]() |
1 | 1 | |||||||
MIRT440311 | LRRC1 | leucine rich repeat containing 1 | ![]() |
1 | 1 | |||||||
MIRT440475 | IAPP | islet amyloid polypeptide | ![]() |
1 | 1 | |||||||
MIRT440511 | HERC2 | HECT and RLD domain containing E3 ubiquitin protein ligase 2 | ![]() |
1 | 1 | |||||||
MIRT440617 | FOXA2 | forkhead box A2 | ![]() |
1 | 1 | |||||||
MIRT440666 | FBXL16 | F-box and leucine rich repeat protein 16 | ![]() |
1 | 1 | |||||||
MIRT440705 | ERO1LB | endoplasmic reticulum oxidoreductase 1 beta | ![]() |
1 | 1 | |||||||
MIRT441007 | CAPZA2 | capping actin protein of muscle Z-line alpha subunit 2 | ![]() |
1 | 1 | |||||||
MIRT441018 | CAND1 | cullin associated and neddylation dissociated 1 | ![]() |
1 | 1 | |||||||
MIRT441062 | C1orf43 | chromosome 1 open reading frame 43 | ![]() |
1 | 1 | |||||||
MIRT441209 | ARCN1 | archain 1 | ![]() |
1 | 1 | |||||||
MIRT449461 | HAT1 | histone acetyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467104 | SRI | sorcin | ![]() |
![]() |
2 | 2 | ||||||
MIRT468060 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 10 | ||||||
MIRT468476 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT473533 | MAX | MYC associated factor X | ![]() |
![]() |
2 | 2 | ||||||
MIRT473852 | MAP2K4 | mitogen-activated protein kinase kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474711 | KIF13A | kinesin family member 13A | ![]() |
![]() |
2 | 6 | ||||||
MIRT481665 | ARAP2 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485120 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493055 | MTFR1 | mitochondrial fission regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504258 | C1orf147 | chromosome 1 open reading frame 147 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504361 | ARID1B | AT-rich interaction domain 1B | ![]() |
![]() |
2 | 4 | ||||||
MIRT505748 | SENP1 | SUMO1/sentrin specific peptidase 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT506298 | PCMTD1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508442 | ZNF608 | zinc finger protein 608 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512782 | COL4A3BP | collagen type IV alpha 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT520447 | TSPAN2 | tetraspanin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT522133 | NRBF2 | nuclear receptor binding factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT522395 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 4 | ||||||
MIRT523397 | GRIK3 | glutamate ionotropic receptor kainate type subunit 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523938 | E2F8 | E2F transcription factor 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524349 | CREB1 | cAMP responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524711 | BRMS1L | breast cancer metastasis-suppressor 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT525134 | ZNF256 | zinc finger protein 256 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525710 | DCAF12L2 | DDB1 and CUL4 associated factor 12 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531264 | PPIL3 | peptidylprolyl isomerase like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538844 | BTG1 | BTG anti-proliferation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541366 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT542093 | KCNK10 | potassium two pore domain channel subfamily K member 10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT543770 | RBM12B | RNA binding motif protein 12B | ![]() |
![]() |
2 | 4 | ||||||
MIRT543940 | NCOA7 | nuclear receptor coactivator 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545150 | GABRG1 | gamma-aminobutyric acid type A receptor gamma1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT545842 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548057 | GOLGA7 | golgin A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549242 | ATXN1L | ataxin 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT551829 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT552484 | ZNF136 | zinc finger protein 136 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553663 | TGFBR2 | transforming growth factor beta receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554988 | RAB39B | RAB39B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT555760 | PCTP | phosphatidylcholine transfer protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT556923 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT564991 | WNK1 | WNK lysine deficient protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566458 | PGGT1B | protein geranylgeranyltransferase type I subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT566538 | PANK3 | pantothenate kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567732 | DLX2 | distal-less homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570081 | KANSL1L | KAT8 regulatory NSL complex subunit 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT571735 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573529 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT574459 | RPS16 | ribosomal protein S16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574992 | Phka1 | phosphorylase kinase alpha 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT576349 | Pxdn | peroxidasin | ![]() |
![]() |
2 | 2 | ||||||
MIRT610196 | CD99 | CD99 molecule (Xg blood group) | ![]() |
![]() |
2 | 4 | ||||||
MIRT612920 | GPRIN3 | GPRIN family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615021 | DUSP6 | dual specificity phosphatase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623573 | IRS1 | insulin receptor substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624437 | CASD1 | CAS1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628714 | ZNF585A | zinc finger protein 585A | ![]() |
![]() |
2 | 2 | ||||||
MIRT639565 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT641485 | POLA2 | DNA polymerase alpha 2, accessory subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT641657 | PAPOLG | poly(A) polymerase gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT642210 | RUVBL2 | RuvB like AAA ATPase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653010 | STX7 | syntaxin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656130 | MSH6 | mutS homolog 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656893 | KIAA2018 | upstream transcription factor family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660130 | BRPF3 | bromodomain and PHD finger containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660855 | AFAP1 | actin filament associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676843 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 3 | ||||||
MIRT681473 | DIP2A | disco interacting protein 2 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT682253 | RS1 | retinoschisin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694296 | COPB2 | coatomer protein complex subunit beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694401 | ALDH1A3 | aldehyde dehydrogenase 1 family member A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705277 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720833 | C1orf52 | chromosome 1 open reading frame 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT735713 | SIRT1 | sirtuin 1 | ![]() |
![]() |
2 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|