pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-2115 |
Genomic Coordinates | chr3: 48316360 - 48316459 |
Description | Homo sapiens miR-2115 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-2115-3p | |||||||||
Sequence | 58| CAUCAGAAUUCAUGGAGGCUAG |79 | |||||||||
Evidence | Experimental | |||||||||
Experiments | 454 | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MTCH1 | ||||||||||||||||||||
Synonyms | CGI-64, PIG60, PSAP, SLC25A49 | ||||||||||||||||||||
Description | mitochondrial carrier 1 | ||||||||||||||||||||
Transcript | NM_014341 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MTCH1 | |||||||||||||||||||||
3'UTR of MTCH1 (miRNA target sites are highlighted) |
>MTCH1|NM_014341|3'UTR 1 CCTGAATCATCTAAAAAACACGGTCTCAACCTGGCCACCGTGGGTGAGGCCTGACCACCTTGGGACACCTGCAAGACGAC 81 TCCAACCCAACAACAACCAGATGTGCTCCAGCCCAGCCGGGCTTCAGTTCCATATTTGCCATGTGTCTGTCCAGATGTGG 161 GGTTGAGCGGGGGTGGGGCTGCACCCAGTGGATTGGGTCACCCGGCAGACCTAGGGAAGGTGAGGCGAGGTGGGGAGTTG 241 GCAGAATCCCCATACCTCGCAGATTTGCTGAGTCTGTCTTGTGCAGAGGGCCAGAGAATGGCTTATGGGGGCCCAGGTTG 321 GATGGGGAAAGGCTAATGGGGTCAGACCCCACCCCGTCTACCCCTCCAGTCAGCCCAGCGCCCATCCTGCAGCTCAGCTG 401 GGAGCATCATTCTCCTGCTTTGTACATAGGGTGTGGTCCCCTGGCACGTGGCCACCATCATGTCTAGGCCTATGCTAGGA 481 GGCAAATGGCCAGGCTCTGCCTGTGTTTTTCTCAACACTACTTTTCTGATATGAGGGCAGCACCTGCCTCTGAATGGGAA 561 ATCATGCAACTACTCAGAATGTGTCCTCCTCATCTAATGCTCATCTGTTTAATGGTGATGCCTCGCGTACAGGATCTGGT 641 TACCTGTGCAGTTGTGAATACCCAGAGGTTGGGCAGATCAGTGTCTCTAGTCCTACCCAGTTTTAAAGTTCATGGTAAGA 721 TTTGACCTCATCTCCCGCAAATAAATGTATTGGTGATTTGGAGTTTTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | C8166 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000373616.5 | 3UTR | UUUUUCUCAACACUACUUUUCUGAUAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT057089 | DDIT4 | DNA damage inducible transcript 4 | 2 | 2 | ||||||||
MIRT071216 | FCF1 | FCF1, rRNA-processing protein | 2 | 2 | ||||||||
MIRT226901 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | 2 | 2 | ||||||||
MIRT235961 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT294569 | ZNF460 | zinc finger protein 460 | 2 | 4 | ||||||||
MIRT321046 | RAC1 | Rac family small GTPase 1 | 2 | 4 | ||||||||
MIRT359666 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | 2 | 8 | ||||||||
MIRT366451 | KLHL15 | kelch like family member 15 | 2 | 2 | ||||||||
MIRT405375 | ZBTB18 | zinc finger and BTB domain containing 18 | 2 | 2 | ||||||||
MIRT441794 | TCEAL5 | transcription elongation factor A like 5 | 2 | 2 | ||||||||
MIRT443295 | TCEAL3 | transcription elongation factor A like 3 | 2 | 2 | ||||||||
MIRT455275 | DDX39B | DExD-box helicase 39B | 2 | 2 | ||||||||
MIRT458523 | C5orf22 | chromosome 5 open reading frame 22 | 2 | 2 | ||||||||
MIRT464960 | TWIST1 | twist family bHLH transcription factor 1 | 2 | 2 | ||||||||
MIRT466848 | STX6 | syntaxin 6 | 2 | 2 | ||||||||
MIRT469252 | RHOB | ras homolog family member B | 2 | 2 | ||||||||
MIRT469825 | RAB14 | RAB14, member RAS oncogene family | 2 | 4 | ||||||||
MIRT470047 | PTGFRN | prostaglandin F2 receptor inhibitor | 2 | 2 | ||||||||
MIRT471420 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | 2 | 2 | ||||||||
MIRT472024 | NPM1 | nucleophosmin 1 | 2 | 2 | ||||||||
MIRT484156 | CENPN | centromere protein N | 2 | 2 | ||||||||
MIRT485490 | HMGN2 | high mobility group nucleosomal binding domain 2 | 2 | 2 | ||||||||
MIRT490462 | PROSER2 | proline and serine rich 2 | 2 | 2 | ||||||||
MIRT493069 | MTCH1 | mitochondrial carrier 1 | 2 | 2 | ||||||||
MIRT493573 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | 2 | 8 | ||||||||
MIRT494919 | NDUFC2-KCTD14 | NDUFC2-KCTD14 readthrough | 2 | 2 | ||||||||
MIRT500439 | ZMAT3 | zinc finger matrin-type 3 | 2 | 2 | ||||||||
MIRT500931 | SRPR | SRP receptor alpha subunit | 2 | 4 | ||||||||
MIRT501551 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | 2 | 2 | ||||||||
MIRT501809 | NEURL1B | neuralized E3 ubiquitin protein ligase 1B | 2 | 2 | ||||||||
MIRT502415 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | 2 | 2 | ||||||||
MIRT506504 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | 2 | 2 | ||||||||
MIRT507861 | CCNE2 | cyclin E2 | 2 | 2 | ||||||||
MIRT510511 | YOD1 | YOD1 deubiquitinase | 2 | 6 | ||||||||
MIRT516073 | RAB42 | RAB42, member RAS oncogene family | 2 | 2 | ||||||||
MIRT519030 | KYNU | kynureninase | 2 | 6 | ||||||||
MIRT521762 | PPIL1 | peptidylprolyl isomerase like 1 | 2 | 4 | ||||||||
MIRT522898 | KCNJ3 | potassium voltage-gated channel subfamily J member 3 | 2 | 4 | ||||||||
MIRT527370 | MGARP | mitochondria localized glutamic acid rich protein | 2 | 2 | ||||||||
MIRT530691 | C8orf46 | chromosome 8 open reading frame 46 | 2 | 2 | ||||||||
MIRT530867 | TRUB1 | TruB pseudouridine synthase family member 1 | 2 | 2 | ||||||||
MIRT531832 | MTPAP | mitochondrial poly(A) polymerase | 2 | 4 | ||||||||
MIRT533035 | ZBTB5 | zinc finger and BTB domain containing 5 | 2 | 2 | ||||||||
MIRT533165 | WIPF2 | WAS/WASL interacting protein family member 2 | 2 | 2 | ||||||||
MIRT533464 | TRIM71 | tripartite motif containing 71 | 2 | 2 | ||||||||
MIRT534331 | SHCBP1 | SHC binding and spindle associated 1 | 2 | 2 | ||||||||
MIRT539372 | ADSS | adenylosuccinate synthase | 2 | 6 | ||||||||
MIRT545951 | ZBTB10 | zinc finger and BTB domain containing 10 | 2 | 2 | ||||||||
MIRT553283 | TSR1 | TSR1, ribosome maturation factor | 2 | 2 | ||||||||
MIRT553532 | TMEM185B | transmembrane protein 185B | 2 | 4 | ||||||||
MIRT556480 | LIPA | lipase A, lysosomal acid type | 2 | 2 | ||||||||
MIRT556975 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | 2 | 2 | ||||||||
MIRT557697 | GATA6 | GATA binding protein 6 | 2 | 2 | ||||||||
MIRT558901 | CCDC58 | coiled-coil domain containing 58 | 2 | 2 | ||||||||
MIRT559224 | BLMH | bleomycin hydrolase | 2 | 2 | ||||||||
MIRT559827 | SLPI | secretory leukocyte peptidase inhibitor | 2 | 2 | ||||||||
MIRT563435 | SLC3A2 | solute carrier family 3 member 2 | 2 | 2 | ||||||||
MIRT569270 | PCDH11X | protocadherin 11 X-linked | 2 | 2 | ||||||||
MIRT571386 | JKAMP | JNK1/MAPK8-associated membrane protein | 2 | 2 | ||||||||
MIRT572567 | AFF1 | AF4/FMR2 family member 1 | 2 | 2 | ||||||||
MIRT610400 | AR | androgen receptor | 2 | 2 | ||||||||
MIRT611058 | ZNF621 | zinc finger protein 621 | 2 | 2 | ||||||||
MIRT635118 | TMEM233 | transmembrane protein 233 | 2 | 2 | ||||||||
MIRT641617 | DEFB118 | defensin beta 118 | 2 | 2 | ||||||||
MIRT642146 | CHORDC1 | cysteine and histidine rich domain containing 1 | 2 | 2 | ||||||||
MIRT647295 | C8orf33 | chromosome 8 open reading frame 33 | 2 | 2 | ||||||||
MIRT648155 | MPLKIP | M-phase specific PLK1 interacting protein | 2 | 2 | ||||||||
MIRT652780 | TENM3 | teneurin transmembrane protein 3 | 2 | 2 | ||||||||
MIRT657356 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | 2 | 2 | ||||||||
MIRT658718 | ELN | elastin | 2 | 2 | ||||||||
MIRT662441 | RALGAPA1 | Ral GTPase activating protein catalytic alpha subunit 1 | 2 | 2 | ||||||||
MIRT665302 | ZBTB38 | zinc finger and BTB domain containing 38 | 2 | 2 | ||||||||
MIRT699898 | RUNX1 | runt related transcription factor 1 | 2 | 2 | ||||||||
MIRT700921 | PDS5A | PDS5 cohesin associated factor A | 2 | 2 | ||||||||
MIRT700992 | PDE3A | phosphodiesterase 3A | 2 | 2 | ||||||||
MIRT707397 | DCAF4L1 | DDB1 and CUL4 associated factor 4 like 1 | 2 | 2 | ||||||||
MIRT711895 | INSIG2 | insulin induced gene 2 | 2 | 2 | ||||||||
MIRT712072 | XRCC5 | X-ray repair cross complementing 5 | 2 | 2 | ||||||||
MIRT716121 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | 1 | 1 | ||||||||
MIRT724470 | SMAD2 | SMAD family member 2 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|