miRTarBase - #MIRT493196


—
pre-miRNA Information
pre-miRNA hsa-mir-4463   
Genomic Coordinates chr6: 75428407 - 75428473
Description Homo sapiens miR-4463 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4463
Sequence 40| GAGACUGGGGUGGGGCC |56
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1176036098 3 dbSNP
rs368879370 7 dbSNP
rs991713068 9 dbSNP
rs909477315 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MID1IP1   
Synonyms G12-like, MIG12, S14R, STRAIT11499, THRSPL
Description MID1 interacting protein 1
Transcript NM_001098790   
Other Transcripts NM_001098791 , NM_021242   
Expression
Putative miRNA Targets on MID1IP1
3'UTR of MID1IP1
(miRNA target sites are highlighted)		 
>MID1IP1|NM_001098790|3'UTR
   1 GGCGTGGCGCCCGTGGCTGCCCAGCACCTTCTTCGACCCATCTCACCCTCTCTCATTCCTCAAAGCTTTTTTTTTTTTTC
  81 CTGGCTGGGGGGCGGGAAGGGCAGACTGCAAACTGGGGGGCTGCGTACGTGCAGGAGGCGCGGTGGGGCTGCGTGGAGGA
 161 GGGGGCCACGTGTGAGAGAGAAGAAAATGGTGGCCGGAGATGGGAGGGCCCAAGGAACCTCCTGGGAGGGGGCCTGCATT
 241 CTATGTTGGTGGGAATGGGACTGGGCTGACGCCCTGCATTCAGCCTGTGCCTTTCCTGGGGTTTCTTTTCTGTTCTTTTC
 321 GGAGGAGAGGGCCCGAGAAGGGGCCATACCAGGGCGCGGCGCTGGGTTGCCACACTTGGGAAAGCAGCCCGGAGCTGGGT
 401 GCTGGGGAAGGCGGGGCGCGTAGCCTCCCGCCGCCCTGCGGTTGGGCCGGTGGAGGCCCAGGCGTTGCTAGGATTGCATC
 481 AGTTTTCCTGTTTGCACTATTTCTTTTTGTAACATTGGCCCTGTGTGAAGTATTTCGAATCTCCTCCTTGCTCTGAAACT
 561 TCAGCGATTCCATTGTGATAAGCGCACAAACAGCACTGTCTGTCGGTAATCGGTACTACTTTATTAATGATTTTCTGTTA
 641 CACTGTATAGTAGTCCTATGGCACCCCCACCCCATCCCTTTCGTGCCACTCCCGTCCCCACCCCCACCCCAGTGTGTATA
 721 AGCTGGCATTTCGCCAGCTTGTACGTAGCTTGCCACTCAGTGAAAATAATAACATTATTATGAGAAAGTGGACTTAACCG
 801 AAATGGAACCAACTGACATTCTATCGTGTTGTACATAGAATGATGAAGGGTTCCACTGTTGTTGTATGTCTTAAATTTAT
 881 TTAAAACTTTTTTTAATCCAGATGTAGACTATATTCTAAAAAATAAAAAAGCAAATGTGTCAACTAAATTGGACAAGCGT
 961 CTGGTCCTCATTAATCTGCCAATGAATGGTTTCGTCATTAAATAAAAATCAATTTAATTGATTTACTAGCAAAAAAAAAA
1041 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccGGGGUGGGGUCAGAg 5'
            |||||||||||| | 
Target 5' acCCCCACCCCAGTGTg 3'
 700 - 716 143.00 -26.10
2 
miRNA  3' ccggGGUGGGGUCAGAg 5'
              :::| :||||:| 
Target 5' aggaTTGCATCAGTTTt 3'
 470 - 486 113.00 -9.00
3 
miRNA  3' ccggGGUGGGGUCAGag 5'
              ||||:|| |||  
Target 5' cgtgCCACTCCCGTCcc 3'
 682 - 698 109.00 -18.20
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767712037 2 dbSNP
rs753032455 7 dbSNP
rs755955303 8 dbSNP
rs755767509 10 dbSNP
rs777757865 13 dbSNP
rs749204158 16 dbSNP
rs755608626 18 dbSNP
rs930031396 26 dbSNP
rs1267660288 28 dbSNP
rs745321576 36 dbSNP
rs1166240424 37 dbSNP
rs1178275277 37 dbSNP
rs1378155847 39 dbSNP
rs1461397707 44 dbSNP
rs771552016 46 dbSNP
rs775111460 48 dbSNP
rs752177738 67 dbSNP
rs755817753 67 dbSNP
rs781606175 67 dbSNP
rs192249335 76 dbSNP
rs1356187068 77 dbSNP
rs1263787655 78 dbSNP
rs78591831 80 dbSNP
rs1416659096 81 dbSNP
rs76217664 82 dbSNP
rs1350156796 84 dbSNP
rs1224513982 85 dbSNP
rs1226078231 85 dbSNP
rs1344118070 87 dbSNP
rs1297985695 88 dbSNP
rs1364993142 89 dbSNP
rs1436624987 105 dbSNP
rs1168579285 115 dbSNP
rs1353413041 115 dbSNP
rs1286865023 117 dbSNP
rs1004201441 120 dbSNP
rs1392426032 121 dbSNP
rs1428321189 121 dbSNP
rs769454034 125 dbSNP
rs1257059831 131 dbSNP
rs1485724826 143 dbSNP
rs772768826 145 dbSNP
rs1251151670 146 dbSNP
rs1189504043 161 dbSNP
rs1202952483 161 dbSNP
rs1483956374 165 dbSNP
rs1275117579 168 dbSNP
rs1232324867 169 dbSNP
rs1047582651 171 dbSNP
rs1303041696 173 dbSNP
rs1219438085 174 dbSNP
rs1472097655 179 dbSNP
rs1177408987 196 dbSNP
rs748742853 202 dbSNP
rs1349354583 203 dbSNP
rs1016957576 206 dbSNP
rs1408574751 207 dbSNP
rs1372890626 214 dbSNP
rs962929688 220 dbSNP
rs1465887967 229 dbSNP
rs770437312 234 dbSNP
rs1178575909 238 dbSNP
rs1431171668 243 dbSNP
rs886254383 260 dbSNP
rs574351078 263 dbSNP
rs1016173350 265 dbSNP
rs759460075 269 dbSNP
rs1252502696 272 dbSNP
rs1482188025 275 dbSNP
rs1257484283 282 dbSNP
rs900378115 290 dbSNP
rs1436481563 291 dbSNP
rs926751645 297 dbSNP
rs960899338 302 dbSNP
rs1350531015 307 dbSNP
rs1308417773 308 dbSNP
rs774465747 313 dbSNP
rs995861040 314 dbSNP
rs1304888354 317 dbSNP
rs1443279539 318 dbSNP
rs767406073 321 dbSNP
rs1388242604 327 dbSNP
rs1029975975 332 dbSNP
rs954473663 335 dbSNP
rs762281078 336 dbSNP
rs1041336915 342 dbSNP
rs1020912437 343 dbSNP
rs1420755994 352 dbSNP
rs1329308845 358 dbSNP
rs1264287736 361 dbSNP
rs1350728338 385 dbSNP
rs1339185958 387 dbSNP
rs935886853 389 dbSNP
rs968908502 390 dbSNP
rs1364919192 391 dbSNP
rs775326850 401 dbSNP
rs1318855322 413 dbSNP
rs899785501 414 dbSNP
rs760420345 418 dbSNP
rs765451012 429 dbSNP
rs933819497 431 dbSNP
rs1370168119 432 dbSNP
rs927568595 459 dbSNP
rs143804380 463 dbSNP
rs992799074 465 dbSNP
rs917234016 468 dbSNP
rs930083782 471 dbSNP
rs1190123396 479 dbSNP
rs1465015524 481 dbSNP
rs1266089617 489 dbSNP
rs1207501961 494 dbSNP
rs1487398027 497 dbSNP
rs1047132181 498 dbSNP
rs1267824348 500 dbSNP
rs1247335005 514 dbSNP
rs1341917272 515 dbSNP
rs758484637 520 dbSNP
rs886304459 528 dbSNP
rs1327199257 531 dbSNP
rs773615107 533 dbSNP
rs1323122919 538 dbSNP
rs1190459931 543 dbSNP
rs1395424256 563 dbSNP
rs766562096 566 dbSNP
rs1164194132 574 dbSNP
rs372834283 595 dbSNP
rs183405109 597 dbSNP
rs1166628496 600 dbSNP
rs755518226 601 dbSNP
rs900431056 607 dbSNP
rs996082026 614 dbSNP
rs1410562497 630 dbSNP
rs1196302237 632 dbSNP
rs1452891426 650 dbSNP
rs1268908498 659 dbSNP
rs1223888762 660 dbSNP
rs1331153710 662 dbSNP
rs781586836 667 dbSNP
rs1231142124 669 dbSNP
rs868150292 670 dbSNP
rs1030028347 674 dbSNP
rs868109699 675 dbSNP
rs1373624828 677 dbSNP
rs924814209 680 dbSNP
rs1297422703 681 dbSNP
rs1219004829 689 dbSNP
rs1338218979 695 dbSNP
rs1214601010 696 dbSNP
rs1303765848 697 dbSNP
rs1409166163 699 dbSNP
rs1368576174 700 dbSNP
rs866918780 701 dbSNP
rs1043814 702 dbSNP
rs867401491 707 dbSNP
rs1212677116 708 dbSNP
rs1170459319 709 dbSNP
rs1180762941 712 dbSNP
rs1478767484 712 dbSNP
rs1471309750 713 dbSNP
rs1253457743 723 dbSNP
rs1469603609 727 dbSNP
rs1438817283 738 dbSNP
rs1186628024 742 dbSNP
rs1247285659 745 dbSNP
rs1198955450 755 dbSNP
rs1347349586 758 dbSNP
rs1475687950 759 dbSNP
rs1227916558 765 dbSNP
rs1348675099 772 dbSNP
rs1290201177 774 dbSNP
rs890124471 778 dbSNP
rs1358364396 783 dbSNP
rs9887 788 dbSNP
rs1411708874 797 dbSNP
rs887159778 798 dbSNP
rs1415839835 801 dbSNP
rs753062489 832 dbSNP
rs780021977 857 dbSNP
rs1157911897 859 dbSNP
rs1004315963 862 dbSNP
rs1010025654 863 dbSNP
rs1455253701 867 dbSNP
rs1165851440 875 dbSNP
rs756453681 876 dbSNP
rs1470762036 880 dbSNP
rs1237300132 886 dbSNP
rs1016907833 887 dbSNP
rs1264034693 888 dbSNP
rs1462918692 888 dbSNP
rs768586680 888 dbSNP
rs898509471 891 dbSNP
rs12832786 892 dbSNP
rs1327180326 896 dbSNP
rs761042790 904 dbSNP
rs1433301613 907 dbSNP
rs1224300307 909 dbSNP
rs968831613 930 dbSNP
rs1320503123 932 dbSNP
rs1033935549 937 dbSNP
rs961272498 938 dbSNP
rs777423451 941 dbSNP
rs978968955 943 dbSNP
rs1327585061 944 dbSNP
rs1319547658 945 dbSNP
rs878900871 958 dbSNP
rs1034900972 960 dbSNP
rs748938960 962 dbSNP
rs1159147368 967 dbSNP
rs1401820665 981 dbSNP
rs1021554668 986 dbSNP
rs1232316653 995 dbSNP
rs967078742 1010 dbSNP
rs958974628 1013 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccggggUGGGGUCAGag 5'
                ||:|| |||  
Target 5' ------ACUCCCGUCcc 3'
 		1 - 11
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000336949.6 | 3UTR | ACUCCCGUCCCCACCCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
66 hsa-miR-4463 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060168 UHMK1 U2AF homology motif kinase 1 2 2
MIRT096415 C5ORF22 chromosome 5 open reading frame 22 2 2
MIRT366792 GNL3L G protein nucleolar 3 like 2 6
MIRT448501 RYBP RING1 and YY1 binding protein 2 2
MIRT454909 SEPT8 septin 8 2 17
MIRT459019 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT459809 POTED POTE ankyrin domain family member D 2 8
MIRT475351 IFNLR1 interferon lambda receptor 1 2 2
MIRT476621 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT479292 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT480204 CAD carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 2 2
MIRT480765 BMP2 bone morphogenetic protein 2 2 2
MIRT481415 ASXL1 additional sex combs like 1, transcriptional regulator 2 2
MIRT482754 HES7 hes family bHLH transcription factor 7 2 10
MIRT483376 SPATA6 spermatogenesis associated 6 2 4
MIRT487803 GPR20 G protein-coupled receptor 20 2 4
MIRT493196 MID1IP1 MID1 interacting protein 1 2 2
MIRT495617 ZNF736 zinc finger protein 736 2 2
MIRT495977 TBC1D19 TBC1 domain family member 19 2 2
MIRT496914 RTKN rhotekin 2 2
MIRT497320 SH3BP5 SH3 domain binding protein 5 2 2
MIRT498993 HAT1 histone acetyltransferase 1 2 10
MIRT500660 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT507809 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT508170 FRK fyn related Src family tyrosine kinase 2 4
MIRT509524 INTU inturned planar cell polarity protein 2 8
MIRT509544 BTLA B and T lymphocyte associated 2 8
MIRT515760 KRTAP5-6 keratin associated protein 5-6 2 2
MIRT516036 PTAFR platelet activating factor receptor 2 2
MIRT516935 THAP1 THAP domain containing 1 2 2
MIRT517672 TRIM72 tripartite motif containing 72 2 2
MIRT521149 SFT2D2 SFT2 domain containing 2 2 2
MIRT526292 KY kyphoscoliosis peptidase 2 2
MIRT526917 ZNF772 zinc finger protein 772 2 6
MIRT527796 KLRD1 killer cell lectin like receptor D1 2 2
MIRT529879 RBM43 RNA binding motif protein 43 2 2
MIRT535894 MLEC malectin 2 2
MIRT536651 INIP INTS3 and NABP interacting protein 2 2
MIRT537349 FKBP15 FK506 binding protein 15 2 2
MIRT539658 SERPINH1 serpin family H member 1 2 2
MIRT543388 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT546878 PURB purine rich element binding protein B 2 2
MIRT547980 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT552836 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT555426 PPIC peptidylprolyl isomerase C 2 2
MIRT559550 ARGLU1 arginine and glutamate rich 1 2 4
MIRT560476 ENSA endosulfine alpha 2 2
MIRT561483 TBC1D4 TBC1 domain family member 4 2 2
MIRT561571 SLC6A9 solute carrier family 6 member 9 2 2
MIRT563869 FAM206A family with sequence similarity 206 member A 2 2
MIRT568210 CAV1 caveolin 1 2 2
MIRT569740 GPR173 G protein-coupled receptor 173 2 2
MIRT570623 MAP1B microtubule associated protein 1B 2 2
MIRT570676 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT576586 Ptbp1 polypyrimidine tract binding protein 1 2 2
MIRT640732 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT643705 KIAA0586 KIAA0586 2 2
MIRT644333 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT670466 RSBN1L round spermatid basic protein 1 like 2 2
MIRT672558 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT685442 SLC10A6 solute carrier family 10 member 6 2 2
MIRT686803 SOX12 SRY-box 12 2 2
MIRT694912 THAP6 THAP domain containing 6 2 2
MIRT702222 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT735058 CYP19A1 cytochrome P450 family 19 subfamily A member 1 3 0
MIRT735059 ESR1 estrogen receptor 1 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4463 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4463 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4463 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-mir-4463 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4463 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4463 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-4463 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4463 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4463 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4463 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4463 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4463 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4463 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4463 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)

Error report submission