miRTarBase - #MIRT494919


—
pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-3p
Sequence 58| CAUCAGAAUUCAUGGAGGCUAG |79
Evidence Experimental
Experiments 454
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31490809 22 COSMIC
COSN31579735 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs543123304 18 dbSNP
rs1450988157 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NDUFC2-KCTD14
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaucggagGUACUUAAGACUac 5'
                  || | |||||||  
Target 5' --uuggcaCA-GCAUUCUGA-- 3'
 		1 - 17
Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000528251.1 | 3UTR | UUGGCACAGCAUUCUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057089 DDIT4 DNA damage inducible transcript 4 2 2
MIRT071216 FCF1 FCF1, rRNA-processing protein 2 2
MIRT226901 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT235961 BACH1 BTB domain and CNC homolog 1 2 2
MIRT294569 ZNF460 zinc finger protein 460 2 4
MIRT321046 RAC1 Rac family small GTPase 1 2 4
MIRT359666 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 8
MIRT366451 KLHL15 kelch like family member 15 2 2
MIRT405375 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT441794 TCEAL5 transcription elongation factor A like 5 2 2
MIRT443295 TCEAL3 transcription elongation factor A like 3 2 2
MIRT455275 DDX39B DExD-box helicase 39B 2 2
MIRT458523 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT464960 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT466848 STX6 syntaxin 6 2 2
MIRT469252 RHOB ras homolog family member B 2 2
MIRT469825 RAB14 RAB14, member RAS oncogene family 2 4
MIRT470047 PTGFRN prostaglandin F2 receptor inhibitor 2 2
MIRT471420 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT472024 NPM1 nucleophosmin 1 2 2
MIRT484156 CENPN centromere protein N 2 2
MIRT485490 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT490462 PROSER2 proline and serine rich 2 2 2
MIRT493069 MTCH1 mitochondrial carrier 1 2 2
MIRT493573 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 8
MIRT494919 NDUFC2-KCTD14 NDUFC2-KCTD14 readthrough 2 2
MIRT500439 ZMAT3 zinc finger matrin-type 3