miRTarBase - #MIRT495235


—
pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-5p
Sequence 16| UAAAUCCCAUGGUGCCUUCUCCU |38
Evidence Experimental
Experiments SAGE
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 10 + 51299590 29233923, 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs113212828 2 dbSNP
rs1265154909 7 dbSNP
rs76759855 9 dbSNP
rs1032735304 10 dbSNP
rs1318073696 10 dbSNP
rs1486056689 11 dbSNP
rs1225930966 12 dbSNP
rs1011066926 14 dbSNP
rs1261327694 19 dbSNP
rs1020985018 22 dbSNP
rs1426923077 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LONRF3   
Synonyms RNF127
Description LON peptidase N-terminal domain and ring finger 3
Transcript NM_001031855   
Other Transcripts NM_024778   
Expression
Putative miRNA Targets on LONRF3
3'UTR of LONRF3
(miRNA target sites are highlighted)		 
>LONRF3|NM_001031855|3'UTR
   1 TGAGTGGATTGCCGAAGAGGAGCTCCCACCTTCCCCACTGCCGTCGGGGGGAGTCTTCTTGTAAATATATCTAATTGCAA
  81 TAATATCTTAACAGAAGGGGGTGTCAAACAGAGGCATCAGCCTGCTGTTGATCACAGAGAGAAATTGAGTAGAAAGACCA
 161 AAAGAATGTGACCTATTTGAAACTTTCTGTCTTAAGATGCTTCTTGACATGCTGCATAACTACATAAACAGCAGAGGTGT
 241 TTAAGAGCCCAGAAAAACATAATTTGATTTTAACATTAAAATTTCCAAAAGTTTAAAGTGGTTTTGCTTTAATATTCTTT
 321 CTTTCATAGATCAATGACTGTGTGGTTGAAATGTGAAAACAAAGATACTAATAATGTTGCTGTATAATTTCACTGACTTG
 401 AGGTCTCATTCCAAATGGTTCAGGTTTTATAGAGCATTGTGTAAAATAATGTTCATACTTCTTTCTGTTTTAATAATTTA
 481 TTTTTTGCACTACTGTATCCTTTTTTCTACATGTATGTTTGTAACTATTTAAGCGTACATTGCTGAAAAGTCCATTGCTT
 561 TATTTATTGATGTGGTTTACCATGTACCTAGGGGGAAATAACAATACTAGAAGTGTGCAGTTTTTGCTTTTATCTTTTTT
 641 TTACTACAATGACACTAGTTCTTAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uccUCUUCCGUGGU-ACCCUAAAu 5'
             | ||  || ||  || :||| 
Target 5' tacATAA-ACAGCAGAGGTGTTTa 3'
 221 - 243 99.00 -6.90
2 
miRNA  3' uccucuuccGUGGUACCCUAAAu 5'
                   ||  | |||:| | 
Target 5' atatcttaaCAGAAGGGGGTGTc 3'
 83 - 105 98.00 -10.73
3 
miRNA  3' uccucuuCCGUGG-UACCCUAAau 5'
                 | |::| : |||| |  
Target 5' ccccactGCCGTCGGGGGGAGTct 3'
 33 - 56 92.00 -9.80
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1222495247 2 dbSNP
rs748623665 12 dbSNP
rs375923891 14 dbSNP
rs371970117 15 dbSNP
rs747303193 16 dbSNP
rs771115655 23 dbSNP
rs373397719 26 dbSNP
rs762681783 33 dbSNP
rs199530252 34 dbSNP
rs369410971 44 dbSNP
rs201498505 46 dbSNP
rs368497017 46 dbSNP
rs751295997 46 dbSNP
rs774395040 46 dbSNP
rs761792690 47 dbSNP
rs767202719 51 dbSNP
rs1268917188 59 dbSNP
rs918556643 69 dbSNP
rs1210631379 74 dbSNP
rs931301249 94 dbSNP
rs754966281 99 dbSNP
rs1048672765 101 dbSNP
rs1321385674 108 dbSNP
rs1282503783 115 dbSNP
rs1219618382 119 dbSNP
rs890020415 121 dbSNP
rs1225695017 125 dbSNP
rs1369376018 142 dbSNP
rs1268058437 147 dbSNP
rs1007034898 148 dbSNP
rs1328750077 152 dbSNP
rs781098454 165 dbSNP
rs1226713440 177 dbSNP
rs1056017080 184 dbSNP
rs1404580250 200 dbSNP
rs900940751 201 dbSNP
rs1415419399 209 dbSNP
rs7879672 215 dbSNP
rs769737503 217 dbSNP
rs1481791240 218 dbSNP
rs1248852790 225 dbSNP
rs751926977 237 dbSNP
rs1460004653 245 dbSNP
rs1010975809 261 dbSNP
rs1262435719 263 dbSNP
rs1252180985 279 dbSNP
rs757713267 301 dbSNP
rs777857577 302 dbSNP
rs1210655217 312 dbSNP
rs1313879132 317 dbSNP
rs969688278 324 dbSNP
rs1472055135 336 dbSNP
rs1213749884 339 dbSNP
rs1156386377 345 dbSNP
rs749506555 368 dbSNP
rs915495155 373 dbSNP
rs981953771 377 dbSNP
rs1163913359 385 dbSNP
rs1347904694 393 dbSNP
rs774873597 397 dbSNP
rs927746720 440 dbSNP
rs1302908381 455 dbSNP
rs1449486060 457 dbSNP
rs781411925 487 dbSNP
rs1361372771 489 dbSNP
rs1168833672 490 dbSNP
rs960113428 491 dbSNP
rs972851187 497 dbSNP
rs1170645557 506 dbSNP
rs1408198204 514 dbSNP
rs1295233852 517 dbSNP
rs759970022 521 dbSNP
rs1182491978 522 dbSNP
rs918656514 535 dbSNP
rs772773482 536 dbSNP
rs1203602570 540 dbSNP
rs1048855254 544 dbSNP
rs923954115 554 dbSNP
rs1276355571 575 dbSNP
rs1243395225 583 dbSNP
rs746075758 588 dbSNP
rs34187529 590 dbSNP
rs200257474 591 dbSNP
rs761436957 600 dbSNP
rs764677780 608 dbSNP
rs1397241381 616 dbSNP
rs1381990879 618 dbSNP
rs1296913926 621 dbSNP
rs1040468729 635 dbSNP
rs922044674 635 dbSNP
rs932498320 650 dbSNP
rs1368093338 658 dbSNP
rs942923253 665 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BAC-D2
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1133252. RNA binding protein: AGO2. Condition:Untreated ...

- Majoros WH; Lekprasert P; Mukherjee N; et al., 2013, Nature methods.

Article - Majoros WH; Lekprasert P; Mukherjee N; et al.
- Nature methods, 2013
High-throughput sequencing has opened numerous possibilities for the identification of regulatory RNA-binding events. Cross-linking and immunoprecipitation of Argonaute proteins can pinpoint a microRNA (miRNA) target site within tens of bases but leaves the identity of the miRNA unresolved. A flexible computational framework, microMUMMIE, integrates sequence with cross-linking features and reliably identifies the miRNA family involved in each binding event. It considerably outperforms sequence-only approaches and quantifies the prevalence of noncanonical binding modes.
LinkOut: [PMID: 23708386]
CLIP-seq Support 1 for dataset GSM1133252
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BAC-D2 / Untreated
Location of target site ENST00000304778.7 | 3UTR | UUGGCCUAGAUUAUGGUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23708386 / GSE46611
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.938 0.11 1.000 0.5 3 Click to see details
HNSC 0.312 0.12 0.429 0.05 16 Click to see details
PAAD 0.918 0.13 0.500 0.33 3 Click to see details
UCEC 0.416 0.13 0.017 0.48 9 Click to see details
BLCA -0.275 0.21 -0.382 0.12 11 Click to see details
KIRC -0.156 0.22 -0.131 0.26 27 Click to see details
BRCA 0.109 0.24 0.128 0.2 46 Click to see details
LUSC 0.139 0.26 0.039 0.43 23 Click to see details
LIHC 0.133 0.29 0.078 0.37 20 Click to see details
PRAD 0.187 0.33 -0.048 0.46 8 Click to see details
STAD -0.061 0.4 0.082 0.37 18 Click to see details
THCA -0.026 0.43 0.074 0.31 48 Click to see details
KICH -0.019 0.47 0.143 0.31 15 Click to see details
KIRP 0.017 0.47 0.115 0.33 17 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
LUAD -0.017 0.48 -0.050 0.45 9 Click to see details
107 hsa-miR-605-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001230 SEC24D SEC24 homolog D, COPII coat complex component 3 1
MIRT016155 TP53 tumor protein p53 2 1
MIRT016156 TCEAL1 transcription elongation factor A like 1 1 1
MIRT016157 MDM2 MDM2 proto-oncogene 2 1
MIRT040476 YBX1 Y-box binding protein 1 1 1
MIRT040477 TMEM64 transmembrane protein 64 1 1
MIRT040478 KDM5C lysine demethylase 5C 1 1
MIRT040479 TRAF4 TNF receptor associated factor 4 1 1
MIRT040480 DRG1 developmentally regulated GTP binding protein 1 1 1
MIRT040481 BCL9 B-cell CLL/lymphoma 9 1 1
MIRT055125 SCD stearoyl-CoA desaturase 2 2
MIRT057521 CEP55 centrosomal protein 55 2 2
MIRT081129 LDLR low density lipoprotein receptor 2 6
MIRT096817 ZSWIM6 zinc finger SWIM-type containing 6 2 4
MIRT100961 CENPQ centromere protein Q 2 4
MIRT263338 ANAPC16 anaphase promoting complex subunit 16 2 2
MIRT274710 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT311193 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT360127 DEK DEK proto-oncogene 2 2
MIRT438269 PSMD10 proteasome 26S subunit, non-ATPase 10 2 1
MIRT442464 SLC25A13 solute carrier family 25 member 13 2 2
MIRT446110 TSC22D2 TSC22 domain family member 2 2 2
MIRT463119 ZNF507 zinc finger protein 507 2 2
MIRT470566 POU2F1 POU class 2 homeobox 1 2 2
MIRT475059 IVNS1ABP influenza virus NS1A binding protein 2 6
MIRT482538 ACTB actin beta 2 4
MIRT494136 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT495209 EDN3 endothelin 3 2 2
MIRT495235 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT496762 MANBAL mannosidase beta like 2 2
MIRT498885 ZNF12 zinc finger protein 12 2 10
MIRT499280 NBPF11 NBPF member 11 2 2
MIRT507063 H3F3B H3 histone family member 3B 2 2
MIRT508352 HES7 hes family bHLH transcription factor 7 2 8
MIRT510740 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT519872 ZFP62 ZFP62 zinc finger protein 2 4
MIRT521272 RTN4 reticulon 4 2 4
MIRT522324 NFIB nuclear factor I B 2 6
MIRT525011 ACTN4 actinin alpha 4 2 6
MIRT526608 AASDH aminoadipate-semialdehyde dehydrogenase 2 4
MIRT529043 ARL9 ADP ribosylation factor like GTPase 9 2 2
MIRT529545 ZNF678 zinc finger protein 678 2 2
MIRT532500 HOXA13 homeobox A13 2 2
MIRT532599 SIX4 SIX homeobox 4 2 2
MIRT534044 STK4 serine/threonine kinase 4 2 2
MIRT534087 SPPL3 signal peptide peptidase like 3 2 2
MIRT534249 SLC16A1 solute carrier family 16 member 1 2 2
MIRT534286 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534555 RUNX1 runt related transcription factor 1 2 2
MIRT536765 HOXB2 homeobox B2 2 2
MIRT537227 GAN gigaxonin 2 2
MIRT551105 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT552247 DUSP3 dual specificity phosphatase 3 2 2
MIRT554361 SFXN5 sideroflexin 5 2 2
MIRT557402 H3F3C H3 histone family member 3C 2 2
MIRT559116 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT560494 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT562296 GLO1 glyoxalase I 2 2
MIRT562597 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT563857 ALYREF Aly/REF export factor 2 4
MIRT565665 SIX1 SIX homeobox 1 2 2
MIRT568253 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT609593 GPM6B glycoprotein M6B 2 2
MIRT611552 GGT6 gamma-glutamyltransferase 6 2 2
MIRT613451 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT615516 PRRC2A proline rich coiled-coil 2A 2 2
MIRT617766 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT619134 MCOLN3 mucolipin 3 2 2
MIRT621365 CAP2 cyclase associated actin cytoskeleton regulatory protein 2 2 2
MIRT625804 MDC1 mediator of DNA damage checkpoint 1 2 2
MIRT626954 PRDM2 PR/SET domain 2 2 2
MIRT627716 RCAN1 regulator of calcineurin 1 2 2
MIRT628069 KCNJ13 potassium voltage-gated channel subfamily J member 13 2 2
MIRT630451 GTPBP8 GTP binding protein 8 (putative) 2 2
MIRT635533 ELMOD2 ELMO domain containing 2 2 2
MIRT636206 SULF2 sulfatase 2 2 2
MIRT638763 EPHA4 EPH receptor A4 2 2
MIRT640324 STAT1 signal transducer and activator of transcription 1 2 2
MIRT644548 SPOP speckle type BTB/POZ protein 2 2
MIRT645114 TMX2 thioredoxin related transmembrane protein 2 2 2
MIRT647778 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT650112 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT650136 ABCB7 ATP binding cassette subfamily B member 7 2 2
MIRT650310 SLC35E2 solute carrier family 35 member E2 2 2
MIRT650930 ST6GALNAC1 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 2 2
MIRT651018 ZNF740 zinc finger protein 740 2 2
MIRT653541 SLC38A9 solute carrier family 38 member 9 2 2
MIRT655752 NR2C2 nuclear receptor subfamily 2 group C member 2 2 2
MIRT656908 KIAA1958 KIAA1958 2 2
MIRT657854 GJD3 gap junction protein delta 3 2 2
MIRT658215 FBXO21 F-box protein 21 2 2
MIRT659884 CAPN7 calpain 7 2 2
MIRT659922 CACNA1E calcium voltage-gated channel subunit alpha1 E 2 2
MIRT660055 C12orf5 TP53 induced glycolysis regulatory phosphatase 1 1
MIRT664616 LIMD1 LIM domains containing 1 2 2
MIRT665392 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT667887 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT669018 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT688419 DUSP2 dual specificity phosphatase 2 2 2
MIRT691888 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT709530 GEN1 GEN1, Holliday junction 5' flap endonuclease 2 2
MIRT711013 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT714731 CENPH centromere protein H 2 2
MIRT719897 PTGIS prostaglandin I2 synthase 2 2
MIRT725028 CX3CL1 C-X3-C motif chemokine ligand 1 2 2
MIRT734348 P2RY12 purinergic receptor P2Y12 3 0
MIRT736719 TNFAIP3 TNF alpha induced protein 3 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-605-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-605-5p Navitoclax 24978538 NSC759659 sensitive High Colorectal Cancer cell line (HCT-116, CHL1)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Cancer cell line (BxPC‐3, PANC‐1)
hsa-miR-605-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H358, H1155)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer tissue
hsa-miR-605-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer tissue
hsa-miR-605-5p Fluorouracil 3385 NSC19893 approved resistant Low Colon Cancer cell line (HT-29, LoVo)
hsa-miR-605-5p Everolimus + Panobinostat sensitive Low Clear Cell Renal Cell Carcinoma tissue
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-605-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-605-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-605-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-605-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-605-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-605-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-605-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-605-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-605-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)
hsa-miR-605-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission