miRTarBase - #MIRT495549


—
pre-miRNA Information
pre-miRNA hsa-mir-4323   
Genomic Coordinates chr19: 42133445 - 42133513
Description Homo sapiens miR-4323 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4323
Sequence 42| CAGCCCCACAGCCUCAGA |59
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs549311114 1 dbSNP
rs896027609 6 dbSNP
rs1057502968 11 dbSNP
rs773276005 11 dbSNP
rs1454618841 12 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ANKRD65   
Synonyms -
Description ankyrin repeat domain 65
Transcript NM_001145210   
Expression
Putative miRNA Targets on ANKRD65
3'UTR of ANKRD65
(miRNA target sites are highlighted)		 
>ANKRD65|NM_001145210|3'UTR
   1 GCCAGACAGCAGGCTCCAGGCTCCACCGCCCCAGTGATTTCCAGGCTCTCTGGCTGAGGCTGCCTGCCTGGAGGGGACAT
  81 CAGGGAAGAGGCTTCCGGAGGAGGGGATGGGAGAAAGTAGGGGATGTGGCTTGAGCTGCAGTCACAGGCCTTGGCTGGAC
 161 CAGGGATGGCCCCCAGCTCCCAGGAGGGCCCACTGACCCTGCAGCTCCAGCCTTCTCCATACTTCAACAAAGAATGAGTT
 241 GTGGCAATGAGGGAAGAGAGACCCTCTCATAGTGTTTTATACTCAGTACCTGTTTTAAGAAAAAACAACAAGGAAGTAAA
 321 ACCAAAGACAGGCAGGCAGCCTGGCGCTAGGCCCGAAACCAGGCCTGCGCCTGCCTGGCCTAAACCCAGTAGTTGAAAAT
 401 CAATTCATAACTTAGAAACCGATGTTATTCATAGATTCCAGACATTGTATAGAAGAACATTTGTGAAACTCCCTGCCGTG
 481 TTCTGTTTCTCTCTGACCGCCGGTGCATGCAGCCCCTGTCACGTACCGCCTGCTTGCTCAAATCAATGACGACCCTTTCA
 561 TGTGAAATCTTCGGTGTTGTGAGCCCTTAAAAGGGACAGAAATTGTGCACTTGGGGAGCTCGGATTTTAAGGCAGTAGCT
 641 TGCCGATGCTCCCAGCTGAATAAAGCCCTTCCTTCTACAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agacUCCGAC--ACCCCGAc 5'
              |||| |  ||| ||| 
Target 5' aggcAGGCAGCCTGGCGCTa 3'
 330 - 349 120.00 -8.00
2 
miRNA  3' agacUCCGA-----C-ACCCCGAc 5'
              |||||     | || |||| 
Target 5' ttccAGGCTCTCTGGCTGAGGCTg 3'
 39 - 62 114.00 -19.36
3 
miRNA  3' agacUCCGACACCCCGAc 5'
              |||   || |||| 
Target 5' aagtAGGGGATGTGGCTt 3'
 115 - 132 114.00 -11.16
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20090118 23 COSMIC
COSN30139769 41 COSMIC
COSN30143140 83 COSMIC
COSN30143444 84 COSMIC
COSN30117664 97 COSMIC
COSN30116528 110 COSMIC
COSN5354044 308 COSMIC
COSN5197456 373 COSMIC
COSN8890185 458 COSMIC
COSN20428414 505 COSMIC
COSN2526717 523 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs958246663 2 dbSNP
rs746571576 5 dbSNP
rs530181812 17 dbSNP
rs567364330 18 dbSNP
rs1232915360 19 dbSNP
rs999571168 21 dbSNP
rs902292160 22 dbSNP
rs550784600 23 dbSNP
rs1407736049 24 dbSNP
rs1271333248 26 dbSNP
rs530596627 27 dbSNP
rs1406975283 28 dbSNP
rs1363590079 30 dbSNP
rs1165858707 31 dbSNP
rs1387950911 33 dbSNP
rs1219797224 34 dbSNP
rs564880536 36 dbSNP
rs1279573566 37 dbSNP
rs754835672 41 dbSNP
rs997582862 44 dbSNP
rs1257789047 48 dbSNP
rs1181341601 52 dbSNP
rs1460528008 66 dbSNP
rs1419098037 69 dbSNP
rs1781132 71 dbSNP
rs1210515849 72 dbSNP
rs1039013995 81 dbSNP
rs1433365644 87 dbSNP
rs941981357 88 dbSNP
rs1245192557 96 dbSNP
rs1323253305 97 dbSNP
rs909108828 104 dbSNP
rs1452171904 105 dbSNP
rs1366106347 108 dbSNP
rs1424053890 117 dbSNP
rs942018628 122 dbSNP
rs1478518486 131 dbSNP
rs1021446194 133 dbSNP
rs1381038711 141 dbSNP
rs887815325 142 dbSNP
rs528081883 155 dbSNP
rs929937607 158 dbSNP
rs1459809184 159 dbSNP
rs1367066655 165 dbSNP
rs762764038 170 dbSNP
rs559252117 171 dbSNP
rs982227041 172 dbSNP
rs1259301189 184 dbSNP
rs1390266475 188 dbSNP
rs766217210 197 dbSNP
rs1212722808 202 dbSNP
rs760979970 208 dbSNP
rs1210337236 215 dbSNP
rs1312945882 216 dbSNP
rs189158795 218 dbSNP
rs1289315166 228 dbSNP
rs1245527565 236 dbSNP
rs1343070271 238 dbSNP
rs1221695347 239 dbSNP
rs575959379 243 dbSNP
rs916779596 245 dbSNP
rs1325903389 247 dbSNP
rs1278985087 256 dbSNP
rs1399284347 262 dbSNP
rs1364173752 263 dbSNP
rs1302860029 264 dbSNP
rs754132664 266 dbSNP
rs1370744578 269 dbSNP
rs1304319053 272 dbSNP
rs573649377 278 dbSNP
rs958329636 280 dbSNP
rs1371984541 284 dbSNP
rs948456380 309 dbSNP
rs1266527226 312 dbSNP
rs1434767766 312 dbSNP
rs1032986249 314 dbSNP
rs1277088305 318 dbSNP
rs563224009 324 dbSNP
rs915667123 325 dbSNP
rs989890073 330 dbSNP
rs1275512204 334 dbSNP
rs1236081898 335 dbSNP
rs1344116981 337 dbSNP
rs1423685421 340 dbSNP
rs750721218 345 dbSNP
rs544848787 346 dbSNP
rs1330539855 348 dbSNP
rs1407853464 351 dbSNP
rs575907215 354 dbSNP
rs997258379 358 dbSNP
rs978353561 363 dbSNP
rs1260298991 364 dbSNP
rs967378433 366 dbSNP
rs1030477410 367 dbSNP
rs17161056 368 dbSNP
rs1279443642 370 dbSNP
rs1202203336 371 dbSNP
rs1321458714 375 dbSNP
rs1255828486 377 dbSNP
rs1202000816 380 dbSNP
rs998095610 386 dbSNP
rs1038894999 388 dbSNP
rs1320339407 406 dbSNP
rs143038747 420 dbSNP
rs887719292 421 dbSNP
rs1334755896 422 dbSNP
rs1334280624 426 dbSNP
rs1454156954 429 dbSNP
rs1403239469 438 dbSNP
rs1048072412 440 dbSNP
rs1017696300 444 dbSNP
rs1409899235 448 dbSNP
rs1156537835 450 dbSNP
rs1469842356 451 dbSNP
rs1218129539 452 dbSNP
rs137909727 453 dbSNP
rs1460081880 455 dbSNP
rs1314789814 456 dbSNP
rs1006351838 461 dbSNP
rs1209910834 463 dbSNP
rs1331764363 470 dbSNP
rs918631214 478 dbSNP
rs1046414303 485 dbSNP
rs573277577 486 dbSNP
rs1448504190 494 dbSNP
rs1380026603 495 dbSNP
rs1400602054 498 dbSNP
rs553296673 499 dbSNP
rs535707645 501 dbSNP
rs991024865 502 dbSNP
rs1414233229 504 dbSNP
rs1165778151 507 dbSNP
rs1442935578 508 dbSNP
rs936798451 513 dbSNP
rs1189242223 514 dbSNP
rs907115164 515 dbSNP
rs1240907561 517 dbSNP
rs572705552 518 dbSNP
rs1452607885 520 dbSNP
rs1045530986 522 dbSNP
rs1424963093 523 dbSNP
rs542026272 528 dbSNP
rs774263122 529 dbSNP
rs1182160528 530 dbSNP
rs1313773160 533 dbSNP
rs1459230454 535 dbSNP
rs1239027354 546 dbSNP
rs975706671 550 dbSNP
rs915783500 551 dbSNP
rs964505168 553 dbSNP
rs1429933620 555 dbSNP
rs1337519011 560 dbSNP
rs1017747458 563 dbSNP
rs1304669631 563 dbSNP
rs1006056141 570 dbSNP
rs145233959 572 dbSNP
rs1430429985 573 dbSNP
rs879673438 584 dbSNP
rs1186517493 591 dbSNP
rs1478606397 595 dbSNP
rs1220663163 597 dbSNP
rs1271515820 597 dbSNP
rs1245389841 599 dbSNP
rs568405153 604 dbSNP
rs140214460 605 dbSNP
rs1292733518 607 dbSNP
rs993438802 610 dbSNP
rs935780186 617 dbSNP
rs1368152085 619 dbSNP
rs536884966 621 dbSNP
rs977510157 622 dbSNP
rs571066020 631 dbSNP
rs551262669 635 dbSNP
rs112936646 638 dbSNP
rs1352845356 639 dbSNP
rs1389373085 640 dbSNP
rs559104120 643 dbSNP
rs1415573047 644 dbSNP
rs1031008080 645 dbSNP
rs976395989 650 dbSNP
rs964874647 661 dbSNP
rs1017812518 667 dbSNP
rs1392249891 668 dbSNP
rs1480345765 672 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Disease MIMAT0016875
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agacuccGACACCCCGAc 5'
                 | |||||||| 
Target 5' --gccuaCCGUGGGGCUu 3'
 		1 - 16
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000520296.1 | 3UTR | gccuaccguggggcuu
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
64 hsa-miR-4323 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT052834 NOL11 nucleolar protein 11 1 1
MIRT082489 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT117166 PER1 period circadian clock 1 2 2
MIRT157951 TMEM184B transmembrane protein 184B 2 2
MIRT286013 TVP23B trans-golgi network vesicle protein 23 homolog B 2 2
MIRT310457 REST RE1 silencing transcription factor 2 2
MIRT338984 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT404223 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT451439 TJP3 tight junction protein 3 2 2
MIRT463541 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT466981 STARD7 StAR related lipid transfer domain containing 7 2 4
MIRT479627 CDC25A cell division cycle 25A 2 2
MIRT487983 SEC14L3 SEC14 like lipid binding 3 2 4
MIRT488661 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT489925 RTKN rhotekin 2 2
MIRT490209 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT494896 ZNF662 zinc finger protein 662 2 2
MIRT495380 RELT RELT, TNF receptor 2 2
MIRT495549 ANKRD65 ankyrin repeat domain 65 2 2
MIRT499104 AGRN agrin 2 2
MIRT500036 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501135 SLC2A1 solute carrier family 2 member 1 2 2
MIRT505573 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT508164 ABCC5 ATP binding cassette subfamily C member 5 2 8
MIRT512383 PHB2 prohibitin 2 2 2
MIRT512719 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT520904 STMN1 stathmin 1 2 2
MIRT526361 TIMMDC1 translocase of inner mitochondrial membrane domain containing 1 2 2
MIRT526847 GALNT11 polypeptide N-acetylgalactosaminyltransferase 11 2 2
MIRT526945 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 4
MIRT527028 PABPN1L poly(A) binding protein nuclear 1 like, cytoplasmic 2 2
MIRT527988 TSLP thymic stromal lymphopoietin 2 2
MIRT532202 MPDU1 mannose-P-dolichol utilization defect 1 2 2
MIRT533691 TMEM86A transmembrane protein 86A 2 2
MIRT535020 PRMT7 protein arginine methyltransferase 7 2 4
MIRT535054 PQLC1 PQ loop repeat containing 1 2 2
MIRT538987 BCL2L2 BCL2 like 2 2 2
MIRT552232 SART3 squamous cell carcinoma antigen recognized by T-cells 3 2 2
MIRT553259 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT555157 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT565202 TSC22D4 TSC22 domain family member 4 2 2
MIRT566199 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT566526 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT568464 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT572231 ATG2A autophagy related 2A 2 2
MIRT573096 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 2 2
MIRT573326 RFC5 replication factor C subunit 5 2 2
MIRT632802 KIAA2022 neurite extension and migration factor 2 2
MIRT646433 ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 2 3
MIRT647826 MTG1 mitochondrial ribosome associated GTPase 1 2 4
MIRT652191 TRIM44 tripartite motif containing 44 2 2
MIRT653800 SIRPA signal regulatory protein alpha 2 2
MIRT666949 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT684833 SCAI suppressor of cancer cell invasion 2 2
MIRT687294 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT700188 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT701784 MSL2 MSL complex subunit 2 2 2
MIRT705958 ACY1 aminoacylase 1 2 2
MIRT705998 ABHD14A-ACY1 ABHD14A-ACY1 readthrough 2 2
MIRT717107 PXDC1 PX domain containing 1 2 2
MIRT717586 VTA1 vesicle trafficking 1 2 2
MIRT722148 SLC2A8 solute carrier family 2 member 8 2 2
MIRT723479 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT725221 PEA15 phosphoprotein enriched in astrocytes 15 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4323 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-mir-4323 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-4323 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-4323 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-4323 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-4323 Vincristine 5978 approved sensitive cell line (W1)
hsa-mir-4323 Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-4323 Tripterygium wilfordii Hook F resistant tissue
hsa-miR-4323 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4323 Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4323 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4323 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission