miRTarBase - #MIRT495554


—
pre-miRNA Information
pre-miRNA hsa-mir-6819   
Genomic Coordinates chr22: 36286847 - 36286907
Description Homo sapiens miR-6819 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6819-3p
Sequence 41| AAGCCUCUGUCCCCACCCCAG |61
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1279530967 2 dbSNP
rs967579979 3 dbSNP
rs776891214 4 dbSNP
rs771166635 8 dbSNP
rs747037324 9 dbSNP
rs879248090 11 dbSNP
rs1485325191 12 dbSNP
rs778157316 16 dbSNP
Putative Targets

Gene Information
Gene Symbol GOLGA6L4
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Disease MIMAT0027539
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaccccaccccuguCUCCGAa 5'
                        |||||| 
Target 5' ------gcuuauuuGAGGCUa 3'
 		1 - 15
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000510439.2 | 3UTR | GCUUAUUUGAGGCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-6819-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT358318 PANK3 pantothenate kinase 3 2 2
MIRT454719 UBQLNL ubiquilin like 2 2
MIRT471362 PEG10 paternally expressed 10 2 2
MIRT478101 DLG5 discs large MAGUK scaffold protein 5 2 4
MIRT495554 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT495587 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT508315 RPL18 ribosomal protein L18 2 4
MIRT529183 ADAM33 ADAM metallopeptidase domain 33 2 2
MIRT532035 FHDC1 FH2 domain containing 1 2 2
MIRT545131 ANXA5 annexin A5 2 2
MIRT567288 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT568094 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT573291 DLX4 distal-less homeobox 4 2 2
MIRT575169 Fam120c family with sequence similarity 120, member C 2 2
MIRT609495 DNASE1L3 deoxyribonuclease 1 like 3 2 2
MIRT611264 EHD3 EH domain containing 3 2 2
MIRT613580 POC5 POC5 centriolar protein 2 2
MIRT616520 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT617098 ZNF667 zinc finger protein 667 2 2
MIRT618268 DDX51 DEAD-box helicase 51 2 2
MIRT618294 ZNF682 zinc finger protein 682 2 2
MIRT618617 SHOX short stature homeobox 2 2
MIRT619741 SRFBP1 serum response factor binding protein 1 2 2
MIRT619784 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT621119 SP110 SP110 nuclear body protein 2 2
MIRT622530 RAD51 RAD51 recombinase 2 2
MIRT623088 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623938 FKBP14 FK506 binding protein 14 2 2
MIRT624389 CD84 CD84 molecule 2 2
MIRT624860 ABI2 abl interactor 2 2 2
MIRT628752 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT632243 VTA1 vesicle trafficking 1 2 2
MIRT632987 E2F2 E2F transcription factor 2 2 2
MIRT633695 RBM43 RNA binding motif protein 43 2 2
MIRT633766 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633808 ZNF91 zinc finger protein 91 2 2
MIRT638914 CBLN2 cerebellin 2 precursor 2 2
MIRT641298 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT642123 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT642179 HEBP2 heme binding protein 2 2 2
MIRT642617 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT643325 TMEM151B transmembrane protein 151B 2 2
MIRT644534 TMEM134 transmembrane protein 134 2 2
MIRT645820 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT646093 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646861 SLC35E4 solute carrier family 35 member E4 2 2
MIRT647466 DZIP1L DAZ interacting zinc finger protein 1 like 2 2
MIRT647702 NADSYN1 NAD synthetase 1 2 2
MIRT648082 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648547 TMEM169 transmembrane protein 169 2 2
MIRT648690 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT649747 GNB5 G protein subunit beta 5 2 2
MIRT650154 ZNF426 zinc finger protein 426 2 2
MIRT650450 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650943 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651544 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT652304 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT652890 SYVN1 synoviolin 1 2 2
MIRT654222 RNF19B ring finger protein 19B 2 2
MIRT654676 PSMB5 proteasome subunit beta 5 2 2
MIRT658249 FAXC failed axon connections homolog 2 2
MIRT658363 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT659622 CELF1 CUGBP Elav-like family member 1 2 2
MIRT660171 BNIP3L BCL2 interacting protein 3 like 2 2
MIRT660634 ANKRD52 ankyrin repeat domain 52 2 2
MIRT662428 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT662984 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663939 ZNF554 zinc finger protein 554 2 2
MIRT666960 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT667945 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT668847 CYCS cytochrome c, somatic 2 2
MIRT671792 RGS17 regulator of G protein signaling 17 2 2
MIRT672382 RPL37 ribosomal protein L37 2 2
MIRT673516 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674716 FAM73A mitoguardin 1 2 2
MIRT676352 KLF8 Kruppel like factor 8 2 2
MIRT677820 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT678440 PDE4C phosphodiesterase 4C 2 2
MIRT678499 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT679243 LRP10 LDL receptor related protein 10 2 2
MIRT693607 SLC39A1 solute carrier family 39 member 1 2 2
MIRT695927 ZNF174 zinc finger protein 174 2 2
MIRT697987 TSPAN6 tetraspanin 6 2 2
MIRT700821 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701350 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT702348 KLHL7 kelch like family member 7 2 2
MIRT703387 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT703883 ERBB2IP erbb2 interacting protein 2 2
MIRT708237 PPP1R26 protein phosphatase 1 regulatory subunit 26 2 2
MIRT708629 NUDT18 nudix hydrolase 18 2 2
MIRT708990 CABP4 calcium binding protein 4 2 2
MIRT709804 FOXE1 forkhead box E1 2 2
MIRT710203 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT710248 VAMP1 vesicle associated membrane protein 1 2 2
MIRT710281 FGF1 fibroblast growth factor 1 2 2
MIRT712992 IRGQ immunity related GTPase Q 2 2
MIRT713887 MOB3A MOB kinase activator 3A 2 2
MIRT715600 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT715639 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715686 FRK fyn related Src family tyrosine kinase 2 2
MIRT717053 WIZ widely interspaced zinc finger motifs 2 2
MIRT717611 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT721539 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT722096 SUSD1 sushi domain containing 1 2 2
MIRT722435 HRNR hornerin 2 2
MIRT722855 NEGR1 neuronal growth regulator 1 2 2
MIRT724621 SNAP25 synaptosome associated protein 25 2 2
MIRT724777 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6819 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission