>TUBAL3|NM_001171864|3'UTR
   1 GGCATGTATGATGGGTGCAAATGAATGTCAAGTTAAAATGGCATGTTTTCTTTTCAAGCCGTTATATGCCTAGTGGGTAG
  81 TTCCCCTGATGAGCAGAAAAATGAACTCAAATCAGGCAAGACTCTAGGTTCCACACTAAATTAAGTGGGTCAGTACCAAC
 161 AATGAACACATTATTTCCTGGTCTACTGGTACAAGTCAGCTCTGCTACCTGGGAGCCTTTGGAAGCTTAGAGTCCTTTGA
 241 ACTGCTGAGTCACTTCTAGGTGGGATTTTTTTGTTTTACCAAGAGACAATGAAATCCTGAAGTTTATGCTTTTCCTTTCT
 321 GGTACCGGAAGTAGAAAACAGCACATGTTGATTACGAATGTTTTTTCCCCCATGTCTACATTTTTTACACTGATTAAATC
 401 ATAAATATTTTCAGTATGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aaUUUGGAGAU-----GAU------UCAAGGGu 5' ||:|| :|| ||| ||||||| Target 5' tcAAGCCGTTATATGCCTAGTGGGTAGTTCCCc 3'	54 - 86	150.00	-15.50
2	miRNA 3' aaUUUGGAGAUGAUUCAAGGgu 5' ||: || |||:||||| Target 5' gcAAGACT---CTAGGTTCCac 3'	116 - 134	125.00	-13.40
3	miRNA 3' aaUUUGGAGAUGAUUCAAGggu 5' |||:| ||: |||||: Target 5' tgAAATC-CTG--AAGTTTatg 3'	290 - 308	103.00	-6.02

Mutant ID	Mutant Position	Mutant Source
COSN31561520	12	COSMIC
COSN15666799	50	COSMIC
COSN20124444	55	COSMIC
COSN30502586	61	COSMIC
COSN30478375	75	COSMIC
COSN30521781	108	COSMIC
COSN17811034	153	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs375080713	4	dbSNP
rs782357289	4	dbSNP
rs374383606	5	dbSNP
rs782331894	7	dbSNP
rs782155172	8	dbSNP
rs782041867	12	dbSNP
rs782375509	13	dbSNP
rs782265050	16	dbSNP
rs1224565563	17	dbSNP
rs1282102501	25	dbSNP
rs782587083	29	dbSNP
rs782350511	31	dbSNP
rs782177939	34	dbSNP
rs782579103	37	dbSNP
rs782532892	43	dbSNP
rs781903273	45	dbSNP
rs782641362	50	dbSNP
rs797025893	55	dbSNP
rs536983147	60	dbSNP
rs1048772793	61	dbSNP
rs929940295	72	dbSNP
rs918408743	76	dbSNP
rs1183265501	88	dbSNP
rs1386228472	90	dbSNP
rs566257350	93	dbSNP
rs1157304909	99	dbSNP
rs1407902587	102	dbSNP
rs1399558002	104	dbSNP
rs943857835	106	dbSNP
rs781842853	113	dbSNP
rs1449981008	129	dbSNP
rs1335697642	142	dbSNP
rs911277843	144	dbSNP
rs554114303	152	dbSNP
rs1246725213	153	dbSNP
rs985557136	163	dbSNP
rs968685340	167	dbSNP
rs914600864	169	dbSNP
rs1349855786	171	dbSNP
rs539223143	174	dbSNP
rs782719379	176	dbSNP
rs1286395155	178	dbSNP
rs1321567434	179	dbSNP
rs782071866	185	dbSNP
rs1244012737	188	dbSNP
rs781889200	193	dbSNP
rs1462885673	198	dbSNP
rs1180129671	207	dbSNP
rs1036265586	212	dbSNP
rs571212934	216	dbSNP
rs1470778444	220	dbSNP
rs1160851192	231	dbSNP
rs1413464851	238	dbSNP
rs549479347	240	dbSNP
rs1175181120	244	dbSNP
rs1406376772	253	dbSNP
rs1397474137	254	dbSNP
rs140191891	261	dbSNP
rs1442811143	265	dbSNP
rs1290162300	266	dbSNP
rs1321454913	267	dbSNP
rs1222990445	273	dbSNP
rs192566368	279	dbSNP
rs1347386371	280	dbSNP
rs1194330841	283	dbSNP
rs189143380	284	dbSNP
rs1438774174	285	dbSNP
rs1184547569	289	dbSNP
rs1267383175	297	dbSNP
rs3255	299	dbSNP
rs888101101	302	dbSNP
rs1429461403	305	dbSNP
rs1467233934	315	dbSNP
rs1165843496	317	dbSNP
rs1026685766	319	dbSNP
rs147525113	326	dbSNP
rs897032776	327	dbSNP
rs1041368905	339	dbSNP
rs1343585480	345	dbSNP
rs1404323941	347	dbSNP
rs782357332	355	dbSNP
rs144656534	356	dbSNP
rs1225453030	358	dbSNP
rs1269860036	363	dbSNP
rs1340411805	365	dbSNP
rs1290115056	367	dbSNP
rs201437110	367	dbSNP
rs1490328274	368	dbSNP
rs1223939966	370	dbSNP
rs1267411466	371	dbSNP
rs1434423463	373	dbSNP
rs1190528887	378	dbSNP
rs559083229	389	dbSNP
rs1372153576	393	dbSNP
rs1475587424	402	dbSNP
rs539647765	404	dbSNP
rs749255913	410	dbSNP
rs1423899176	413	dbSNP
rs1303707861	415	dbSNP
rs1392917971	416	dbSNP

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.