miRTarBase - #MIRT495667


—
pre-miRNA Information
pre-miRNA hsa-mir-4301   
Genomic Coordinates chr11: 113450023 - 113450088
Description Homo sapiens miR-4301 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4301
Sequence 11| UCCCACUACUUCACUUGUGA |30
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs184176277 2 dbSNP
rs1191324913 13 dbSNP
rs1369198005 15 dbSNP
rs1036973189 16 dbSNP
rs944900541 18 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TUBAL3   
Synonyms -
Description tubulin alpha like 3
Transcript NM_001171864   
Other Transcripts NM_024803   
Expression
Putative miRNA Targets on TUBAL3
3'UTR of TUBAL3
(miRNA target sites are highlighted)		 
>TUBAL3|NM_001171864|3'UTR
   1 GGCATGTATGATGGGTGCAAATGAATGTCAAGTTAAAATGGCATGTTTTCTTTTCAAGCCGTTATATGCCTAGTGGGTAG
  81 TTCCCCTGATGAGCAGAAAAATGAACTCAAATCAGGCAAGACTCTAGGTTCCACACTAAATTAAGTGGGTCAGTACCAAC
 161 AATGAACACATTATTTCCTGGTCTACTGGTACAAGTCAGCTCTGCTACCTGGGAGCCTTTGGAAGCTTAGAGTCCTTTGA
 241 ACTGCTGAGTCACTTCTAGGTGGGATTTTTTTGTTTTACCAAGAGACAATGAAATCCTGAAGTTTATGCTTTTCCTTTCT
 321 GGTACCGGAAGTAGAAAACAGCACATGTTGATTACGAATGTTTTTTCCCCCATGTCTACATTTTTTACACTGATTAAATC
 401 ATAAATATTTTCAGTATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aguguucacuucAUCACCCu 5'
                      ||||||| 
Target 5' ccgttatatgccTAGTGGGt 3'
 59 - 78 140.00 -10.00
2 
miRNA  3' aguGU-UCACUUCA-UCACCCu 5'
             || | | || | |||||| 
Target 5' ttcCACACTAAATTAAGTGGGt 3'
 129 - 150 121.00 -11.99
3 
miRNA  3' aguGUUCACU--UCAU-CACCCu 5'
             ::||| |    || ||||| 
Target 5' tgcTGAGTCACTTCTAGGTGGGa 3'
 243 - 265 111.00 -11.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31561520 12 COSMIC
COSN15666799 50 COSMIC
COSN20124444 55 COSMIC
COSN30502586 61 COSMIC
COSN30478375 75 COSMIC
COSN30521781 108 COSMIC
COSN17811034 153 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs375080713 4 dbSNP
rs782357289 4 dbSNP
rs374383606 5 dbSNP
rs782331894 7 dbSNP
rs782155172 8 dbSNP
rs782041867 12 dbSNP
rs782375509 13 dbSNP
rs782265050 16 dbSNP
rs1224565563 17 dbSNP
rs1282102501 25 dbSNP
rs782587083 29 dbSNP
rs782350511 31 dbSNP
rs782177939 34 dbSNP
rs782579103 37 dbSNP
rs782532892 43 dbSNP
rs781903273 45 dbSNP
rs782641362 50 dbSNP
rs797025893 55 dbSNP
rs536983147 60 dbSNP
rs1048772793 61 dbSNP
rs929940295 72 dbSNP
rs918408743 76 dbSNP
rs1183265501 88 dbSNP
rs1386228472 90 dbSNP
rs566257350 93 dbSNP
rs1157304909 99 dbSNP
rs1407902587 102 dbSNP
rs1399558002 104 dbSNP
rs943857835 106 dbSNP
rs781842853 113 dbSNP
rs1449981008 129 dbSNP
rs1335697642 142 dbSNP
rs911277843 144 dbSNP
rs554114303 152 dbSNP
rs1246725213 153 dbSNP
rs985557136 163 dbSNP
rs968685340 167 dbSNP
rs914600864 169 dbSNP
rs1349855786 171 dbSNP
rs539223143 174 dbSNP
rs782719379 176 dbSNP
rs1286395155 178 dbSNP
rs1321567434 179 dbSNP
rs782071866 185 dbSNP
rs1244012737 188 dbSNP
rs781889200 193 dbSNP
rs1462885673 198 dbSNP
rs1180129671 207 dbSNP
rs1036265586 212 dbSNP
rs571212934 216 dbSNP
rs1470778444 220 dbSNP
rs1160851192 231 dbSNP
rs1413464851 238 dbSNP
rs549479347 240 dbSNP
rs1175181120 244 dbSNP
rs1406376772 253 dbSNP
rs1397474137 254 dbSNP
rs140191891 261 dbSNP
rs1442811143 265 dbSNP
rs1290162300 266 dbSNP
rs1321454913 267 dbSNP
rs1222990445 273 dbSNP
rs192566368 279 dbSNP
rs1347386371 280 dbSNP
rs1194330841 283 dbSNP
rs189143380 284 dbSNP
rs1438774174 285 dbSNP
rs1184547569 289 dbSNP
rs1267383175 297 dbSNP
rs3255 299 dbSNP
rs888101101 302 dbSNP
rs1429461403 305 dbSNP
rs1467233934 315 dbSNP
rs1165843496 317 dbSNP
rs1026685766 319 dbSNP
rs147525113 326 dbSNP
rs897032776 327 dbSNP
rs1041368905 339 dbSNP
rs1343585480 345 dbSNP
rs1404323941 347 dbSNP
rs782357332 355 dbSNP
rs144656534 356 dbSNP
rs1225453030 358 dbSNP
rs1269860036 363 dbSNP
rs1340411805 365 dbSNP
rs1290115056 367 dbSNP
rs201437110 367 dbSNP
rs1490328274 368 dbSNP
rs1223939966 370 dbSNP
rs1267411466 371 dbSNP
rs1434423463 373 dbSNP
rs1190528887 378 dbSNP
rs559083229 389 dbSNP
rs1372153576 393 dbSNP
rs1475587424 402 dbSNP
rs539647765 404 dbSNP
rs749255913 410 dbSNP
rs1423899176 413 dbSNP
rs1303707861 415 dbSNP
rs1392917971 416 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Disease MIMAT0016850
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aguguucacuucAUCACCCu 5'
                      ||||||| 
Target 5' ---------gccUAGUGGGu 3'
 		1 - 11
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000380419.3 | 3UTR | GCCUAGUGGGUAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4301 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081134 LDLR low density lipoprotein receptor 2 4
MIRT090911 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT229436 MECP2 methyl-CpG binding protein 2 2 2
MIRT274717 CPSF6 cleavage and polyadenylation specific factor 6 2 2
MIRT350957 BACH1 BTB domain and CNC homolog 1 2 2
MIRT386722 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT446022 PEX3 peroxisomal biogenesis factor 3 2 2
MIRT481303 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 14
MIRT483959 ZNF354B zinc finger protein 354B 2 6
MIRT495667 TUBAL3 tubulin alpha like 3 2 2
MIRT496554 TBX15 T-box 15 2 2
MIRT497702 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 2
MIRT498105 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT512535 SEMA4D semaphorin 4D 2 2
MIRT512556 MFN2 mitofusin 2 2 6
MIRT521465 RABGAP1 RAB GTPase activating protein 1 2 6
MIRT526236 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526743 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527578 BRD7 bromodomain containing 7 2 4
MIRT528038 WT1 Wilms tumor 1 2 2
MIRT528267 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT528505 HTR7 5-hydroxytryptamine receptor 7 2 4
MIRT528758 RPS27 ribosomal protein S27 2 6
MIRT528999 IPO9 importin 9 2 2
MIRT529701 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529781 C17orf82 chromosome 17 open reading frame 82 2 2
MIRT533797 TMEM119 transmembrane protein 119 2 6
MIRT535308 PHF12 PHD finger protein 12 2 2
MIRT535917 MKL2 MKL1/myocardin like 2 2 2
MIRT544892 OSBPL1A oxysterol binding protein like 1A 2 2
MIRT555423 PPIC peptidylprolyl isomerase C 2 2
MIRT562068 KLHL15 kelch like family member 15 2 2
MIRT565623 SLC31A1 solute carrier family 31 member 1 2 2
MIRT565661 SIX1 SIX homeobox 1 2 2
MIRT570138 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT571045 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT621232 LMAN1 lectin, mannose binding 1 2 2
MIRT622272 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623844 GAN gigaxonin 2 2
MIRT626158 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626464 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT632087 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT637243 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT642710 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT643611 KANSL3 KAT8 regulatory NSL complex subunit 3 2 2
MIRT644270 PAFAH1B1 platelet activating factor acetylhydrolase 1b regulatory subunit 1 2 2
MIRT645470 SPIN3 spindlin family member 3 2 2
MIRT649193 DNPEP aspartyl aminopeptidase 2 2
MIRT650776 POP4 POP4 homolog, ribonuclease P/MRP subunit 2 2
MIRT651345 ZC2HC1C zinc finger C2HC-type containing 1C 2 2
MIRT652237 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT652587 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654591 PURA purine rich element binding protein A 2 2
MIRT654649 PTAFR platelet activating factor receptor 2 2
MIRT656842 KLF7 Kruppel like factor 7 2 2
MIRT657209 IKZF2 IKAROS family zinc finger 2 2 2
MIRT658513 ETV3 ETS variant 3 2 2
MIRT659448 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT668816 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT669067 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT677711 ELOF1 elongation factor 1 homolog 2 4
MIRT687146 PTPN12 protein tyrosine phosphatase, non-receptor type 12 2 2
MIRT698498 THOC2 THO complex 2 2 2
MIRT707930 PPP1R3D protein phosphatase 1 regulatory subunit 3D 4 2
MIRT708737 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT710031 POLL DNA polymerase lambda 2 2
MIRT712175 STK4 serine/threonine kinase 4 2 2
MIRT715297 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT716892 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT717378 RBM41 RNA binding motif protein 41 2 2
MIRT718082 CLIC5 chloride intracellular channel 5 2 2
MIRT718721 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT719152 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719224 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719528 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT719861 KLF2 Kruppel like factor 2 2 2
MIRT720326 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 2
MIRT721596 SREBF1 sterol regulatory element binding transcription factor 1 2 2
MIRT722020 NEBL nebulette 2 2
MIRT722484 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT722614 TEAD1 TEA domain transcription factor 1 2 2
MIRT723664 RPTN repetin 2 2
MIRT723939 SVOP SV2 related protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive High Hepatocellular Carcinoma cell line (Hep3B, 97L)
hsa-miR-4301 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-mir-4301 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-4301 Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-4301 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-4301 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-miR-4301 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4301 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission