miRTarBase - #MIRT495934


—
pre-miRNA Information
pre-miRNA hsa-mir-6871   
Genomic Coordinates chr20: 41169023 - 41169078
Description Homo sapiens miR-6871 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6871-3p
Sequence 35| CAGCACCCUGUGGCUCCCACAG |56
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN16670239 4 COSMIC
COSN1872096 9 COSMIC
COSM1741616 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs545076040 1 dbSNP
rs1273348199 2 dbSNP
rs1202373059 5 dbSNP
rs1340707970 7 dbSNP
rs372994756 8 dbSNP
rs869070782 15 dbSNP
rs931272568 16 dbSNP
rs1333765165 18 dbSNP
Putative Targets

Gene Information
Gene Symbol SLC7A5P2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Disease MIMAT0027643
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacacccucggugucCCACGAc 5'
                         |||||| 
Target 5' -----gccuaauacaGGUGCU- 3'
 		1 - 16
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000281317.5 | 3UTR | GCCUAAUACAGGUGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
88 hsa-miR-6871-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061678 BTG2 BTG anti-proliferation factor 2 2 4
MIRT116181 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT150139 MIDN midnolin 2 2
MIRT197058 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT225108 GOLGA7 golgin A7 2 2
MIRT376288 CALM3 calmodulin 3 2 2
MIRT454810 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT464228 VEGFA vascular endothelial growth factor A 2 6
MIRT466961 STAT3 signal transducer and activator of transcription 3 2 2
MIRT468219 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT472460 NASP nuclear autoantigenic sperm protein 2 2
MIRT474203 LEPRE1 prolyl 3-hydroxylase 1 1 1
MIRT475836 HDGF heparin binding growth factor 2 4
MIRT478667 CTC1 CST telomere replication complex component 1 2 14
MIRT478707 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT478982 COMMD2 COMM domain containing 2 2 2
MIRT479693 CCNT2 cyclin T2 2 6
MIRT488440 ULBP2 UL16 binding protein 2 2 2
MIRT492511 RAET1L retinoic acid early transcript 1L 2 2
MIRT492975 NCS1 neuronal calcium sensor 1 2 2
MIRT494158 COL4A1 collagen type IV alpha 1 chain 2 6
MIRT495934 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496210 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT496356 PPY pancreatic polypeptide 2 2
MIRT496385 ZC3H6 zinc finger CCCH-type containing 6 2 2
MIRT496463 DCTN5 dynactin subunit 5 2 2
MIRT497642 GLDN gliomedin 2 2
MIRT498496 FRK fyn related Src family tyrosine kinase 2 2
MIRT501928 MCL1 MCL1, BCL2 family apoptosis regulator 2 8
MIRT513286 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT514767 RBM4B RNA binding motif protein 4B 2 2
MIRT514916 MDM2 MDM2 proto-oncogene 2 6
MIRT515669 LRRC27 leucine rich repeat containing 27 2 2
MIRT520367 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT523960 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT526859 KIFC1 kinesin family member C1 2 2
MIRT527673 CASP8 caspase 8 2 2
MIRT527828 TMEM74B transmembrane protein 74B 2 2
MIRT529553 EI24 EI24, autophagy associated transmembrane protein 2 2
MIRT530547 SYNPO synaptopodin 2 2
MIRT531725 TARS threonyl-tRNA synthetase 2 2
MIRT533340 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT533620 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT537226 GAN gigaxonin 2 2
MIRT544430 ZNF460 zinc finger protein 460 2 4
MIRT546905 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547102 PLAG1 PLAG1 zinc finger 2 2
MIRT547820 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT548236 FEM1B fem-1 homolog B 2 2
MIRT550034 WWTR1 WW domain containing transcription regulator 1 2 2
MIRT554337 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT565483 SPRTN SprT-like N-terminal domain 2 2
MIRT568200 CBX6 chromobox 6 2 2
MIRT569754 C2orf71 chromosome 2 open reading frame 71 2 2
MIRT571369 ZNF45 zinc finger protein 45 2 2
MIRT609886 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT640543 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT640885 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT643494 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT643627 YY2 YY2 transcription factor 2 2
MIRT644384 ZNF286A zinc finger protein 286A 2 2
MIRT646126 SLC26A9 solute carrier family 26 member 9 2 2
MIRT655939 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT656057 MYLK4 myosin light chain kinase family member 4 2 2
MIRT658767 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT661583 EPHX2 epoxide hydrolase 2 2 2
MIRT664285 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT689391 ZNF850 zinc finger protein 850 2 2
MIRT694530 TRIM72 tripartite motif containing 72 2 2
MIRT694626 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695133 PRY2 PTPN13-like, Y-linked 2 2 2
MIRT695150 PRY PTPN13-like, Y-linked 2 2
MIRT697468 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT701919 MLXIP MLX interacting protein 2 2
MIRT704548 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT704791 CDK6 cyclin dependent kinase 6 2 2
MIRT705696 ANKRD13A ankyrin repeat domain 13A 2 2
MIRT707992 OTUD4 OTU deubiquitinase 4 2 2
MIRT708739 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT713401 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT713846 FAM3D family with sequence similarity 3 member D 2 2
MIRT716998 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT718511 DIRAS1 DIRAS family GTPase 1 2 2
MIRT718698 BTBD9 BTB domain containing 9 2 2
MIRT719578 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT720892 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT722633 C8A complement C8 alpha chain 2 2
MIRT723333 DGAT1 diacylglycerol O-acyltransferase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6871-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6871-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6871-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6871-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission