miRTarBase - #MIRT495968


—
pre-miRNA Information
pre-miRNA hsa-let-7e   
Genomic Coordinates chr19: 51692786 - 51692864
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1189776118 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TBC1D19   
Synonyms -
Description TBC1 domain family member 19
Transcript NM_018317   
Expression
Putative miRNA Targets on TBC1D19
3'UTR of TBC1D19
(miRNA target sites are highlighted)		 
>TBC1D19|NM_018317|3'UTR
   1 TCTTCTTCACAGTCACTGGCAACACATCTAGTTTTTCATTAGAAACAAATCATGAACTATGCAAACTCTGCATAAAACCA
  81 AAATGAAACTTTGCATATAAGCCAATAAAGATCATGTTCCCTCTTCAGTTAAACCTAAGTAGTTTCTCACTTTTTGAAAC
 161 AATAACTCTGCACCAAATATTGCATCGCATGCTGCTGATTTTCAAGAGAGAAGCAATAAACACAACTTCTGCTAAATTGA
 241 GCATTATATATATAATATTATAATATATATATAATCCTGACTTGTCAATGGCATGTAATAATATATGCAATAAGAACTAA
 321 AGATACTGTAATAAACTTCAAGAGGTAATGTAGCTTCTTGGATAATTCTTTTATGTCAGTTTATAAATTTATCTCTAGAT
 401 AATGTATTGTTTTGTCTCATAAATTGCTCCTCACTAAGAGCCAGGGGTGGGGTAGGGTGTGAGAACACTTGAAAAAGATA
 481 ATGTTTTTAAGTAGGAATTCAAAAGTTGCTTAAATGGTGTTTTAAGCAACTTTTTACACCCCAGGGATTTTCTACATTTC
 561 TCTCCATTTTATTTCTCTCTTTAAACATCTCTACTGGGGAAGGTCGAATACAATTGTCTCCATTTGACAATATTTTATGC
 641 TTGACTCTCTGAAAGTCAGAAAATTATAGGTGATCCCTTTTCACTTCTCAACCTTCCTTCTCTTGCTTAGAAGACTTGAC
 721 ATTGCCGATGCTTGTTGCCAGCTTCTGTTACTTTGTAACTATACAAGGAAGACACCCAAGAGAATGAGGAGTCAAAACCC
 801 CATTCACTTTTGCTGAAGCTTGGTTTAACAAGATTTACTTCTAGGGCAGAGCAGCTGAGAGAGATTAAAAGTAGGTAGTA
 881 GGCATTCATTCTAAACTGCAGACATTATGCAAGGCATCAGCCTTATTTTGGGCTTTATTATAAGTGAAGGGTCTTATTTT
 961 GTATTACTTCCTAAAGACCTACCATTTCTGTAATATGGAATAATAGTATGTGGGGTAAAAAGTCCAAAAACTATTGTCCT
1041 TTGATTTTAGTTTCAAATTTAAGATGCTGATCACTTCACTAAAACTGTAAATCAGTAGATTGATACGCTTATTGATTGCC
1121 TAGAATTTTATTCAGTTTTACCCAAATGTATTTTATGAGTCTTTTATTTTGGCAGTATGTATTAGGAAAAATGCTTGTTG
1201 ATTTACTAAGAGCTGAATAATAATTTATTCCATGATTGATTCTTAATAAACCCCATTTTATTGCTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuGAUAUGUUGGAGGAUGGAGu 5'
            :|| ||||  | :|||:|| 
Target 5' gtTTA-ACAAGAT-TTACTTCt 3'
 823 - 842 122.00 -7.10
2 
miRNA  3' uuGAUAU-GUUGGA-----GGAUGGAGu 5'
            :|||: ||:::|     ::||:||| 
Target 5' ttTTATGTCAGTTTATAAATTTATCTCt 3'
 369 - 396 120.00 -9.50
3 
miRNA  3' uugAU-AUGUUGGA-----GGAUGGagu 5'
             || |||  |||     ||||||   
Target 5' ttgTATTACTTCCTAAAGACCTACCatt 3'
 959 - 986 115.00 -13.86
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30482474 69 COSMIC
COSN30108029 124 COSMIC
COSN30153124 124 COSMIC
COSN30166991 157 COSMIC
COSN31566732 187 COSMIC
COSN20074966 188 COSMIC
COSN19661128 287 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs766130598 1 dbSNP
rs756632506 6 dbSNP
rs952339777 9 dbSNP
rs767016732 17 dbSNP
rs200899849 18 dbSNP
rs986998282 19 dbSNP
rs755061675 23 dbSNP
rs778916715 31 dbSNP
rs747846180 32 dbSNP
rs531574977 33 dbSNP
rs1031519362 42 dbSNP
rs758621840 46 dbSNP
rs1184884034 50 dbSNP
rs1413181416 51 dbSNP
rs1396661988 60 dbSNP
rs1191443795 66 dbSNP
rs980464966 68 dbSNP
rs1034260895 71 dbSNP
rs1386443452 74 dbSNP
rs956120311 81 dbSNP
rs1445323119 87 dbSNP
rs1283709502 96 dbSNP
rs748909619 98 dbSNP
rs1350767825 102 dbSNP
rs548289443 103 dbSNP
rs536385310 106 dbSNP
rs770731180 108 dbSNP
rs914514752 112 dbSNP
rs373178949 122 dbSNP
rs979797692 124 dbSNP
rs1390628934 127 dbSNP
rs1450215604 133 dbSNP
rs532577832 134 dbSNP
rs769551526 143 dbSNP
rs1414876439 147 dbSNP
rs1377136781 165 dbSNP
rs529201701 166 dbSNP
rs925276650 172 dbSNP
rs1383446577 178 dbSNP
rs1420014789 183 dbSNP
rs1418971761 187 dbSNP
rs936683714 188 dbSNP
rs928329594 190 dbSNP
rs527401104 216 dbSNP
rs547384386 223 dbSNP
rs1277915641 233 dbSNP
rs1255962692 236 dbSNP
rs1210833793 238 dbSNP
rs1308427265 240 dbSNP
rs1275625221 241 dbSNP
rs1350040584 251 dbSNP
rs181892570 258 dbSNP
rs1286638208 260 dbSNP
rs150884746 262 dbSNP
rs887270410 268 dbSNP
rs940208523 270 dbSNP
rs15666 272 dbSNP
rs766161525 273 dbSNP
rs1354883226 275 dbSNP
rs1026686520 276 dbSNP
rs1180277238 285 dbSNP
rs1129230 287 dbSNP
rs996771441 292 dbSNP
rs1165949236 294 dbSNP
rs1476203262 295 dbSNP
rs755970867 296 dbSNP
rs1187848082 299 dbSNP
rs1028280965 303 dbSNP
rs1390426939 305 dbSNP
rs535687008 308 dbSNP
rs1481286498 327 dbSNP
rs1235110911 332 dbSNP
rs1129231 336 dbSNP
rs1202801364 340 dbSNP
rs775280471 345 dbSNP
rs1001193534 348 dbSNP
rs1233567697 350 dbSNP
rs1336273878 356 dbSNP
rs1290966538 361 dbSNP
rs1373883856 362 dbSNP
rs760719066 363 dbSNP
rs1008324052 369 dbSNP
rs1439685340 374 dbSNP
rs1032200275 377 dbSNP
rs373819897 388 dbSNP
rs1467845678 398 dbSNP
rs960001782 405 dbSNP
rs955880720 424 dbSNP
rs1392374600 427 dbSNP
rs1164223858 430 dbSNP
rs1419765965 430 dbSNP
rs993125566 437 dbSNP
rs1176018165 444 dbSNP
rs555419659 444 dbSNP
rs1469920116 449 dbSNP
rs774165072 450 dbSNP
rs1020136888 451 dbSNP
rs1213914545 453 dbSNP
rs1021544263 454 dbSNP
rs759469094 456 dbSNP
rs1326734279 460 dbSNP
rs1270888850 468 dbSNP
rs1335047015 482 dbSNP
rs1239897861 483 dbSNP
rs1290218714 486 dbSNP
rs1321685227 489 dbSNP
rs1286206450 491 dbSNP
rs765264702 494 dbSNP
rs1375845353 503 dbSNP
rs1223118195 508 dbSNP
rs925352291 510 dbSNP
rs1442842469 517 dbSNP
rs936698632 530 dbSNP
rs1293187881 531 dbSNP
rs1454339730 534 dbSNP
rs1484422466 541 dbSNP
rs1157532116 544 dbSNP
rs1400698703 546 dbSNP
rs1396063272 554 dbSNP
rs979741934 555 dbSNP
rs1194634694 559 dbSNP
rs985461050 561 dbSNP
rs189107227 567 dbSNP
rs1485889562 568 dbSNP
rs1243392826 578 dbSNP
rs960005565 581 dbSNP
rs944318268 587 dbSNP
rs114727120 594 dbSNP
rs907658506 606 dbSNP
rs78602866 614 dbSNP
rs577994422 619 dbSNP
rs1413459157 624 dbSNP
rs1479286255 625 dbSNP
rs546067484 644 dbSNP
rs1383039049 647 dbSNP
rs1364159140 651 dbSNP
rs1287254870 652 dbSNP
rs1399481709 667 dbSNP
rs920140567 671 dbSNP
rs932920549 676 dbSNP
rs1049686501 677 dbSNP
rs138433442 678 dbSNP
rs1433200390 681 dbSNP
rs1048157891 694 dbSNP
rs1174885437 702 dbSNP
rs531509189 703 dbSNP
rs377504006 706 dbSNP
rs1184201828 707 dbSNP
rs1395687036 710 dbSNP
rs1258094025 716 dbSNP
rs1053205498 717 dbSNP
rs753882520 727 dbSNP
rs1011380999 728 dbSNP
rs1309413379 729 dbSNP
rs1293714472 738 dbSNP
rs1218033514 748 dbSNP
rs1356210157 750 dbSNP
rs1021486564 758 dbSNP
rs542015450 759 dbSNP
rs1401925421 763 dbSNP
rs895436678 764 dbSNP
rs540354104 766 dbSNP
rs1404606824 777 dbSNP
rs1284133921 780 dbSNP
rs1374388009 780 dbSNP
rs1314118597 781 dbSNP
rs1225741167 782 dbSNP
rs1020210185 784 dbSNP
rs1036041329 786 dbSNP
rs1418016191 789 dbSNP
rs1340702547 790 dbSNP
rs1207905433 799 dbSNP
rs1474225060 800 dbSNP
rs959732816 812 dbSNP
rs983558078 830 dbSNP
rs1481503949 836 dbSNP
rs561883659 839 dbSNP
rs1198297514 846 dbSNP
rs1335524124 848 dbSNP
rs149281936 854 dbSNP
rs1340334369 860 dbSNP
rs963104050 862 dbSNP
rs1308367175 873 dbSNP
rs1393461222 875 dbSNP
rs1328848756 877 dbSNP
rs79618486 878 dbSNP
rs974186736 881 dbSNP
rs920104465 888 dbSNP
rs1394577372 891 dbSNP
rs865775830 915 dbSNP
rs765442490 919 dbSNP
rs555041732 921 dbSNP
rs1471529751 932 dbSNP
rs1367768990 946 dbSNP
rs181370512 952 dbSNP
rs932848446 957 dbSNP
rs76307570 968 dbSNP
rs186488437 979 dbSNP
rs1178241354 984 dbSNP
rs944044101 985 dbSNP
rs1275299839 995 dbSNP
rs1053537049 997 dbSNP
rs1211844945 1000 dbSNP
rs1355772189 1001 dbSNP
rs1261794800 1011 dbSNP
rs1372273629 1012 dbSNP
rs1241874956 1013 dbSNP
rs1462490904 1014 dbSNP
rs750578468 1027 dbSNP
rs550435168 1036 dbSNP
rs1363839832 1066 dbSNP
rs1371198693 1072 dbSNP
rs560239652 1073 dbSNP
rs1424117580 1079 dbSNP
rs1403053799 1080 dbSNP
rs911235036 1082 dbSNP
rs758703442 1084 dbSNP
rs1455335520 1096 dbSNP
rs1378245309 1097 dbSNP
rs1370010079 1100 dbSNP
rs1157753898 1101 dbSNP
rs1454568399 1103 dbSNP
rs1255080848 1104 dbSNP
rs1451087936 1105 dbSNP
rs1043193354 1107 dbSNP
rs763109301 1108 dbSNP
rs1001409869 1119 dbSNP
rs1035606063 1121 dbSNP
rs191473771 1126 dbSNP
rs1135204 1136 dbSNP
rs930166958 1149 dbSNP
rs1048561703 1151 dbSNP
rs78949194 1154 dbSNP
rs963066766 1156 dbSNP
rs973111361 1157 dbSNP
rs937114111 1158 dbSNP
rs1383415583 1161 dbSNP
rs1055911415 1163 dbSNP
rs895522592 1172 dbSNP
rs1158007140 1187 dbSNP
rs1435070182 1190 dbSNP
rs1028721028 1212 dbSNP
rs1489290911 1214 dbSNP
rs1041686159 1222 dbSNP
rs1373865280 1230 dbSNP
rs755483004 1233 dbSNP
rs1487360877 1236 dbSNP
rs1263047381 1238 dbSNP
rs1212272607 1243 dbSNP
rs1486842863 1245 dbSNP
rs1277018941 1249 dbSNP
rs954206655 1253 dbSNP
rs1260823527 1256 dbSNP
rs986064444 1273 dbSNP
rs1270421724 1276 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD3
Disease MIMAT0000066
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uugauauguuggaGGAUGGAGu 5'
                       :||||||| 
Target 5' ------------gUCUACCUCu 3'
 		1 - 10
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000264866.4 | 3UTR | GUCUACCUCUGGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC 0.364 0.01 0.341 0.01 49 Click to see details
CESC -0.996 0.03 -1.000 0.5 3 Click to see details
HNSC 0.293 0.03 0.335 0.02 42 Click to see details
STAD 0.319 0.04 0.282 0.06 32 Click to see details
BRCA 0.148 0.09 0.087 0.22 84 Click to see details
THCA 0.176 0.09 0.163 0.11 59 Click to see details
CHOL -0.457 0.11 -0.533 0.07 9 Click to see details
PCPG -0.942 0.11 -1.000 0.5 3 Click to see details
BLCA -0.302 0.11 -0.313 0.1 18 Click to see details
KIRC -0.139 0.13 -0.188 0.06 68 Click to see details
UCEC -0.261 0.14 -0.309 0.1 19 Click to see details
KICH 0.194 0.18 0.205 0.16 25 Click to see details
PRAD -0.132 0.18 -0.036 0.4 50 Click to see details
PAAD 0.63 0.19 0.400 0.3 4 Click to see details
LUSC 0.143 0.2 0.198 0.12 38 Click to see details
KIRP -0.135 0.23 0.024 0.45 32 Click to see details
ESCA 0.219 0.26 -0.009 0.49 11 Click to see details
LUAD 0.109 0.37 -0.035 0.46 12 Click to see details
COAD 0.014 0.49 -0.048 0.46 8 Click to see details
COAD 0.014 0.49 -0.048 0.46 8 Click to see details
COAD 0.014 0.49 -0.048 0.46 8 Click to see details
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 5 5
MIRT003932 EIF3J eukaryotic translation initiation factor 3 subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 4 7
MIRT005718 WNT1 Wnt family member 1 4 1
MIRT006122 CCND1 cyclin D1 5 4
MIRT006404 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN MYCN proto-oncogene, bHLH transcription factor 4 2
MIRT051413 WDR67 TBC1 domain family member 31 1 1
MIRT051414 FAM219B family with sequence similarity 219 member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DGCR8, microprocessor complex subunit 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1 1 1
MIRT051423 SKIV2L Ski2 like RNA helicase 1 1
MIRT051424 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT051429 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT051430 CELF2 CUGBP Elav-like family member 2 1 1
MIRT051431 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CST telomere replication complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13 like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 2 5
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 RCC1 like 1 1
MIRT051456 SLC2A11 solute carrier family 2 member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 VRAC subunit A 1 1
MIRT051459 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT051460 DTNB dystrobrevin beta 1 1
MIRT051461 SCMH1 Scm polycomb group protein homolog 1 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase and N-sulfotransferase 1 1 1
MIRT051466 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 5
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT051473 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 glutamyl-tRNA amidotransferase subunit B 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin like growth factor 1 receptor 5 10
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L cell division cycle 5 like 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT051496 RRAGC Ras related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B semaphorin 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU deubiquitinase 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G 1 1
MIRT051506 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle associated membrane protein 2 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis class P 1 1
MIRT051516 LMLN leishmanolysin like peptidase 1 1
MIRT051517 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monophosphate synthase 1 1
MIRT051524 DIAPH1 diaphanous related formin 1 1 1
MIRT051525 STAM signal transducing adaptor molecule 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT051528 MARCH5 membrane associated ring-CH-type finger 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT051531 NDUFA3 NADH:ubiquinone oxidoreductase subunit A3 1 1
MIRT051532 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 spalt like transcription factor 1 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT051537 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 SUZ12 polycomb repressive complex 2 subunit 1 1
MIRT051543 PAPD4 poly(A) RNA polymerase D4, non-canonical 1 1
MIRT051544 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DExH-box helicase 57 1 1
MIRT051547 KATNB1 katanin regulatory subunit B1 1 1
MIRT051548 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT051549 DHX15 DEAH-box helicase 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2 like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155 2 7
MIRT051558 GNG5 G protein subunit gamma 5 2 3
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 2 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1 regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT051566 SCD stearoyl-CoA desaturase 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 KRAB box domain containing 4 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT051575 SRSF2 serine and arginine rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome subunit alpha 6 1 1
MIRT051580 SLC38A2 solute carrier family 38 member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT051591 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 1 1
MIRT051594 TRPV1 transient receptor potential cation channel subfamily V member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1 like pseudokinase 1 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4 like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 1 1
MIRT051605 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT051606 MS4A10 membrane spanning 4-domains A10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT-rich interaction domain 1A 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 2 5
MIRT051610 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT051611 COX16 COX16, cytochrome c oxidase assembly homolog 1 1
MIRT051612 NUDT8 nudix hydrolase 8 1 1
MIRT051613 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatinase 1 1
MIRT051620 NCKAP5L NCK associated protein 5 like 1 1
MIRT051621 ZFP62 ZFP62 zinc finger protein 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D RNA polymerase III subunit D 2 3
MIRT051624 PRPF8 pre-mRNA processing factor 8 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger AN1-type containing 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain 1B 1 1
MIRT051628 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family member 4A1 1 1
MIRT051636 CCRN4L nocturnin 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 1 1
MIRT051638 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 3
MIRT051640 CLTC clathrin heavy chain 1 1
MIRT051641 TERF1 telomeric repeat binding factor 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like family member 4 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 RB binding protein 4, chromatin remodeling factor 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox 5 2 3
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 marker of proliferation Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog, transcriptional regulator 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA guanine-7 methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 ZFP3 zinc finger protein 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 1 1
MIRT051670 UTP15 UTP15, small subunit processome component 1 1
MIRT051671 THADA THADA, armadillo repeat containing 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein lateral stalk subunit P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity related GTPase Q 1 1
MIRT051681 CA5B carbonic anhydrase 5B 1 1
MIRT051682 COX14 COX14, cytochrome c oxidase assembly factor 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome associated protein homolog 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor family 7 subfamily D member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix hydrolase 15 1 1
MIRT051690 CDH18 cadherin 18 1 1
MIRT051691 FAM160B1 family with sequence similarity 160 member B1 1 1
MIRT051692 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC subunit 1 1 1
MIRT051697 TNFRSF1A TNF receptor superfamily member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase, mitochondrial processing alpha subunit 2 5
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 3
MIRT051708 PSME4 proteasome activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 3 1
MIRT054579 IGF1 insulin like growth factor 1 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 2 2
MIRT065687 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068154 TXLNA taxilin alpha 2 2
MIRT068528 NHLRC3 NHL repeat containing 3 2 6
MIRT068789 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073006 ARID3B AT-rich interaction domain 3B 2 6
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077616 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080398 ONECUT2 one cut homeobox 2 2 2
MIRT083300 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084976 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094160 PCGF3 polycomb group ring finger 3 2 6
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095766 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100094 ABT1 activator of basal transcription 1 2 8
MIRT112242 MDM4 MDM4, p53 regulator 2 4
MIRT118586 STK4 serine/threonine kinase 4 2 2
MIRT120921 PDE12 phosphodiesterase 12 2 8
MIRT123317 CALU calumenin 2 2
MIRT152272 TNFSF9 TNF superfamily member 9 2 2
MIRT153847 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168583 HMGA1 high mobility group AT-hook 1 2 4
MIRT180603 CRY2 cryptochrome circadian clock 2 2 2
MIRT187717 SUOX sulfite oxidase 2 2
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193101 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218815 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240330 UBXN2B UBX domain protein 2B 2 2
MIRT243473 TRIM71 tripartite motif containing 71 2 2
MIRT244069 EDN1 endothelin 1 2 2
MIRT252330 SALL3 spalt like transcription factor 3 2 2
MIRT255314 CDV3 CDV3 homolog 2 2
MIRT259277 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259479 TXLNG taxilin gamma 2 2
MIRT260707 CLDN12 claudin 12 2 6
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266626 CHTOP chromatin target of PRMT1 2 2
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT294446 ZNF264 zinc finger protein 264 2 2
MIRT297013 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297443 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303320 MXD1 MAX dimerization protein 1 2 2
MIRT309846 NAT8L N-acetyltransferase 8 like 2 2
MIRT322428 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324731 ACER2 alkaline ceramidase 2 2 2
MIRT402057 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437395 LIN28A lin-28 homolog A 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 1
MIRT438632 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439135 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442020 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445658 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447136 KIF27 kinesin family member 27 2 2
MIRT448259 ZNF774 zinc finger protein 774 2 2
MIRT449005 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449953 FMNL3 formin like 3 2 2
MIRT451155 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451693 C1RL complement C1r subcomponent like 2 2
MIRT452092 NUCB2 nucleobindin 2 2 2
MIRT452431 QDPR quinoid dihydropteridine reductase 2 2
MIRT452943 DISC1 disrupted in schizophrenia 1 2 2
MIRT453401 RHD Rh blood group D antigen 2 6
MIRT454164 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454280 FXN frataxin 2 2
MIRT454539 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454854 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455676 GLO1 glyoxalase I 2 2
MIRT457248 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457677 ZNF587 zinc finger protein 587 2 2
MIRT457887 THEM6 thioesterase superfamily member 6 2 4
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458279 FUT10 fucosyltransferase 10 2 2
MIRT459736 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460500 FAM105A family with sequence similarity 105 member A 2 6
MIRT460938 NOA1 nitric oxide associated 1 2 4
MIRT461092 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461169 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461364 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462382 YAE1D1 Yae1 domain containing 1 2 2
MIRT462780 ZNF8 zinc finger protein 8 2 2
MIRT463420 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464265 VCL vinculin 2 2
MIRT465122 TSC22D2 TSC22 domain family member 2 2 4
MIRT466184 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469102 RNF144B ring finger protein 144B 2 2
MIRT469714 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470425 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470679 POLR2D RNA polymerase II subunit D 2 4
MIRT470861 PLXND1 plexin D1 2 2
MIRT471271 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471957 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472739 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473134 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473234 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473940 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474022 LRRC20 leucine rich repeat containing 20 2 2
MIRT474502 KLHDC8B kelch domain containing 8B 2 2
MIRT474766 KIAA0930 KIAA0930 2 2
MIRT474905 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475331 IFNLR1 interferon lambda receptor 1 2 2
MIRT475379 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475733 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476548 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476973 FAM83G family with sequence similarity 83 member G 2 4
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477682 EFHD2 EF-hand domain family member D2 2 2
MIRT481201 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481241 ATXN7L3 ataxin 7 like 3 2 2
MIRT481363 ATG9A autophagy related 9A 2 2
MIRT481388 ATG12 autophagy related 12 2 2
MIRT481652 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481851 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482184 AHR aryl hydrocarbon receptor 2 2
MIRT482220 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485296 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486659 ZNF28 zinc finger protein 28 2 2
MIRT489413 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492216 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493323 LIMD2 LIM domain containing 2 2 2
MIRT493901 FAM43A family with sequence similarity 43 member A 2 4
MIRT494263 CEP120 centrosomal protein 120 2 2
MIRT494687 ARID3A AT-rich interaction domain 3A 2 2
MIRT495968 TBC1D19 TBC1 domain family member 19 2 2
MIRT496111 SNX17 sorting nexin 17 2 2
MIRT497875 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498122 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499405 PLCG2 phospholipase C gamma 2 2 4
MIRT499493 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499997 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500819 THBS1 thrombospondin 1 2 3
MIRT500902 STRN striatin 2 4
MIRT501118 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501173 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501202 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501241 SEMA4C semaphorin 4C 2 6
MIRT501328 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501355 RNF44 ring finger protein 44 2 4
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501943 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502106 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502130 KMT2D lysine methyltransferase 2D 2 4
MIRT502784 CEP135 centrosomal protein 135 2 2
MIRT502845 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504789 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505017 ZNF644 zinc finger protein 644 2 2
MIRT506942 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507252 FIGN fidgetin, microtubule severing factor 2 8
MIRT507694 COIL coilin 2 6
MIRT508401 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508665 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508932 AK4 adenylate kinase 4 2 4
MIRT510395 ZNF566 zinc finger protein 566 2 6
MIRT510518 YOD1 YOD1 deubiquitinase 2 6
MIRT511386 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512745 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515954 C9orf156 tRNA methyltransferase O 2 2
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT523619 FZD9 frizzled class receptor 9 2 4
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523990 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524113 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525727 SOD2 superoxide dismutase 2 2 2
MIRT527763 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529727 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533187 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536378 LEFTY1 left-right determination factor 1 2 2
MIRT543785 RBM12B RNA binding motif protein 12B 2 4
MIRT543868 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545387 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545890 ZNF200 zinc finger protein 200 2 4
MIRT546334 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547373 MSI2 musashi RNA binding protein 2 2 2
MIRT547579 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548264 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548351 EPHA4 EPH receptor A4 2 2
MIRT548534 DUSP1 dual specificity phosphatase 1 2 2
MIRT548560 DNAL1 dynein axonemal light chain 1 2 2
MIRT548779 COLEC12 collectin subfamily member 12 2 2
MIRT548978 CCNT2 cyclin T2 2 2
MIRT549208 BEND4 BEN domain containing 4 2 4
MIRT549763 ZNF611 zinc finger protein 611 2 6
MIRT549799 KIAA0391 KIAA0391 2 2
MIRT549847 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551318 GSG2 histone H3 associated protein kinase 2 6
MIRT551932 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552003 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552410 ZNF460 zinc finger protein 460 2 4
MIRT553013 USP38 ubiquitin specific peptidase 38 2 2
MIRT555550 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555711 PDZD8 PDZ domain containing 8 2 2
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557960 FAM222B family with sequence similarity 222 member B 2 2
MIRT559087 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559497 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561772 PEG10 paternally expressed 10 2 2
MIRT564402 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565443 SURF4 surfeit 4 2 2
MIRT566518 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567715 E2F6 E2F transcription factor 6 2 2
MIRT568655 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569498 THYN1 thymocyte nuclear protein 1 2 2
MIRT573820 TGOLN2 trans-golgi network protein 2 2 2
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574750 GOLGA4 golgin A4 2 2
MIRT574788 FAM104A family with sequence similarity 104 member A 2 2
MIRT576089 Poteg POTE ankyrin domain family, member G 2 2
MIRT576812 Thbs1 thrombospondin 1 2 3
MIRT616370 RWDD1 RWD domain containing 1 2 2
MIRT617851 FMO4 flavin containing monooxygenase 4 2 2
MIRT642394 ZNF556 zinc finger protein 556 2 2
MIRT680519 PRIM2 DNA primase subunit 2 2 2
MIRT680547 ZNF584 zinc finger protein 584 2 2
MIRT680800 ZNF578 zinc finger protein 578 2 2
MIRT680838 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681141 INTS7 integrator complex subunit 7 2 2
MIRT681271 RFC2 replication factor C subunit 2 2 2
MIRT681323 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681359 BRI3BP BRI3 binding protein 2 2
MIRT681506 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681536 ZNF738 zinc finger protein 738 2 2
MIRT681658 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681738 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681869 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681941 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682102 ITGA3 integrin subunit alpha 3 2 4
MIRT682181 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682238 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682384 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682444 MTX3 metaxin 3 2 2
MIRT682604 CPA4 carboxypeptidase A4 2 2
MIRT682640 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689327 FPR1 formyl peptide receptor 1 2 2
MIRT689730 ATXN2 ataxin 2 2 2
MIRT691036 ZNF799 zinc finger protein 799 2 2
MIRT691935 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694884 ZNF417 zinc finger protein 417 2 2
MIRT695255 ZNF443 zinc finger protein 443 2 2
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700589 PRSS22 protease, serine 22 2 2
MIRT701428 NHLRC2 NHL repeat containing 2 2 2
MIRT702484 KIAA1328 KIAA1328 2 2
MIRT702715 IPO9 importin 9 2 2
MIRT704028 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704418 CTPS1 CTP synthase 1 2 2
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712373 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713520 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731263 FASLG Fas ligand 3 1
MIRT732697 Ccr7 chemokine (C-C motif) receptor 7 2 0
MIRT732700 Snhg12 small nucleolar RNA host gene 12 2 0
MIRT734626 SYT7 synaptotagmin 7 1 0
MIRT755829 UBQLN4 ubiquilin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7e Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
let-7e Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7e Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7e Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7e Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7e 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7e Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
let-7e Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7e Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
let-7e 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
let-7e Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (A2780)
hsa-let-7e Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7e Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, HO8910, ES2, CAOV3, SKOV3)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-8)
hsa-let-7e Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7C)
hsa-let-7e Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7e Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7e Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-let-7e 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7e Ethanol+Tamoxifen resistant cell line (LY2)
hsa-let-7e Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7e Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7e Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7e Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-let-7e Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-let-7e Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7e-5p Alvocidib 5287969 NSC649890 resistant
hsa-let-7e-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-let-7e-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7e-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-let-7e-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7e-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7e-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-let-7e-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-let-7e-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission