pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4291 |
Genomic Coordinates | chr9: 93819357 - 93819421 |
Description | Homo sapiens miR-4291 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4291 | ||||||||||||
Sequence | 11| UUCAGCAGGAACAGCU |26 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CD180 | ||||||||||||||||||||
Synonyms | LY64, Ly78, RP105 | ||||||||||||||||||||
Description | CD180 molecule | ||||||||||||||||||||
Transcript | NM_005582 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CD180 | |||||||||||||||||||||
3'UTR of CD180 (miRNA target sites are highlighted) |
>CD180|NM_005582|3'UTR 1 TGCTGAAGGTTTCCAGAGAAAGCAAATAAGTGTGCTTAGCAAAATTGCTCTAAGTGAAAGAACTGTCATCTGCTGGTGAC 81 CAGACCAGACTTTTCAGATTGCTTCCTGGAACTGGGCAGGGACTCACTGTGCTTTTCTGAGCTTCTTACTCCTGTGAGTC 161 CCAGAGCTAAAGAACCTTCTAGGCAAGTACACCGAATGACTCAGTCCAGAGGGTCAGATGCTGCTGTGAGAGGCACAGAG 241 CCCTTTCCGCATGTGGAAGAGTGGGAGGAAGCAGAGGGAGGGACTGGGCAGGGACTGCCGGCCCCGGAGTCTCCCACAGG 321 GAGGCCATTCCCCTTCTACTCACCGACATCCCTCCCAGCACCACACACCCCGCCCCTGAAAGGAGATCATCAGCCCCCAC 401 AATTTGTCAGAGCTGAAGCCAGCCCACTACCCACCCCCACTACAGCATTGTGCTTGGGTCTGGGTTCTCAGTAATGTAGC 481 CATTTGAGAAACTTACTTGGGGACAAAGTCTCAATCCTTATTTTAAATGAAAAAAGAAAAGAAAAGCATAATAAATTTAA 561 AAGAAAAGGCTGAGAAATGAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | LCL-BACD3 | ||||||
Disease | MIMAT0016922 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected
... - Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Skalsky RL; Corcoran DL; Gottwein E; Frank et al. - PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
|
CLIP-seq Support 1 for dataset GSM1020025 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1 |
Location of target site | ENST00000256447.4 | 3UTR | GCCUAUGCUGCUGAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22291592 / GSE41437 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT102445 | CALU | calumenin | ![]() |
![]() |
2 | 4 | ||||||
MIRT108677 | ZBTB33 | zinc finger and BTB domain containing 33 | ![]() |
![]() |
2 | 4 | ||||||
MIRT125969 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT179018 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT379033 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT442473 | CPEB4 | cytoplasmic polyadenylation element binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442910 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442979 | ZNF736 | zinc finger protein 736 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445663 | TNFSF15 | TNF superfamily member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446237 | FZD6 | frizzled class receptor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448860 | FAM49B | family with sequence similarity 49 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT455559 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459704 | ZNF641 | zinc finger protein 641 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460608 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT462251 | LAMA4 | laminin subunit alpha 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462469 | FIZ1 | FLT3 interacting zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466656 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | ![]() |
![]() |
2 | 6 | ||||||
MIRT466841 | STX6 | syntaxin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471403 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471517 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471681 | PABPN1 | poly(A) binding protein nuclear 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472858 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT474813 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT474931 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475814 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT480434 | C17orf49 | chromosome 17 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480903 | BCL2L2-PABPN1 | BCL2L2-PABPN1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT481478 | ARL8B | ADP ribosylation factor like GTPase 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT484982 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT485019 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 8 | ||||||
MIRT485036 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 8 | ||||||
MIRT495074 | HEYL | hes related family bHLH transcription factor with YRPW motif-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT496004 | CD180 | CD180 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT500675 | TRIM37 | tripartite motif containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504544 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506782 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507256 | FGF2 | fibroblast growth factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507386 | EN2 | engrailed homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512505 | BTBD19 | BTB domain containing 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516903 | CTSB | cathepsin B | ![]() |
![]() |
2 | 2 | ||||||
MIRT528124 | PPP1R10 | protein phosphatase 1 regulatory subunit 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528874 | ATF3 | activating transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536091 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541079 | RLIM | ring finger protein, LIM domain interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT541099 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT545360 | LIN7C | lin-7 homolog C, crumbs cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT545831 | ZNF367 | zinc finger protein 367 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547115 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547312 | NPTN | neuroplastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT547959 | HIGD1A | HIG1 hypoxia inducible domain family member 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT549943 | RPL7L1 | ribosomal protein L7 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550749 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565145 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT571050 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT571361 | ZNF45 | zinc finger protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610133 | FOXI2 | forkhead box I2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613145 | DSE | dermatan sulfate epimerase | ![]() |
![]() |
2 | 2 | ||||||
MIRT613379 | ABCC12 | ATP binding cassette subfamily C member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615752 | C6 | complement C6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616460 | ADRA2B | adrenoceptor alpha 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT616719 | FEM1B | fem-1 homolog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT618312 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT631491 | RASSF4 | Ras association domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643134 | PLCXD2 | phosphatidylinositol specific phospholipase C X domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643482 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649715 | TWSG1 | twisted gastrulation BMP signaling modulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653542 | SLC38A7 | solute carrier family 38 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666307 | SLC22A3 | solute carrier family 22 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692005 | NAP1L4 | nucleosome assembly protein 1 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696838 | ARL2BP | ADP ribosylation factor like GTPase 2 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT698204 | TMEM248 | transmembrane protein 248 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703316 | GDPD5 | glycerophosphodiester phosphodiesterase domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709376 | FAM13A | family with sequence similarity 13 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT710112 | MED23 | mediator complex subunit 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711975 | HOMER2 | homer scaffolding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712275 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714108 | TMED9 | transmembrane p24 trafficking protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719113 | MAML1 | mastermind like transcriptional coactivator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719727 | SLC39A11 | solute carrier family 39 member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720018 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT720358 | ZBTB8B | zinc finger and BTB domain containing 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT720372 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|