miRTarBase - #MIRT496086


—
pre-miRNA Information
pre-miRNA hsa-mir-642b   
Genomic Coordinates chr19: 45674932 - 45675008
Description Homo sapiens miR-642b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-642b-3p
Sequence 47| AGACACAUUUGGAGAGGGACCC |68
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24410683 6 COSMIC
COSN8407659 14 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778534861 2 dbSNP
rs111664333 4 dbSNP
rs998995912 5 dbSNP
rs1206620651 6 dbSNP
rs1317907103 7 dbSNP
rs374751972 13 dbSNP
rs78902025 15 dbSNP
rs775648115 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C17orf85
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD1 , LCL-BACD3
Disease MIMAT0018444
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020024. RNA binding protein: AGO2. Condition:EBV B95-8-infected "PAR-CLIP data was present in GSM1020025. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cccagggagAGGUUUACACAga 5'
                   ||:  || |||  
Target 5' --------gUCU--AUUUGUga 3'
 		1 - 12
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020024
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD1 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000158149.3 | 3UTR | GUCUAUUUGUGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1020025
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD3 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000158149.3 | 3UTR | GUCUAUUUGUGACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
77 hsa-miR-642b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT082888 ZNF543 zinc finger protein 543 2 2
MIRT108294 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT348737 ZNF350 zinc finger protein 350 2 2
MIRT381384 EXOG exo/endonuclease G 2 2
MIRT452245 TRAM1 translocation associated membrane protein 1 2 2
MIRT459262 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT468117 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468402 SETD3 SET domain containing 3 2 2
MIRT469079 RNF168 ring finger protein 168 2 2
MIRT471690 OXR1 oxidation resistance 1 2 2
MIRT477353 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT479600 CDC25B cell division cycle 25B 2 2
MIRT482377 AFF4 AF4/FMR2 family member 4 2 4
MIRT484029 LARP4B La ribonucleoprotein domain family member 4B 2 2
MIRT490988 USP22 ubiquitin specific peptidase 22 2 2
MIRT493250 MEF2D myocyte enhancer factor 2D 2 2
MIRT493850 FOXN3 forkhead box N3 2 4
MIRT496086 C17orf85 nuclear cap binding subunit 3 2 2
MIRT500630 TXNIP thioredoxin interacting protein 2 2
MIRT501048 SMEK1 protein phosphatase 4 regulatory subunit 3A 2 2
MIRT525186 ZNF257 zinc finger protein 257 2 4
MIRT534875 QSER1 glutamine and serine rich 1 2 2
MIRT539336 AGPAT5 1-acylglycerol-3-phosphate O-acyltransferase 5 2 2
MIRT553814 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT555959 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT556289 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT561212 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT567328 HMGB1 high mobility group box 1 2 2
MIRT572385 LRRC6 leucine rich repeat containing 6 2 2
MIRT575529 Map4 microtubule-associated protein 4 2 2
MIRT575684 Map1b microtubule-associated protein 1B 2 2
MIRT576828 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT576953 Pigs phosphatidylinositol glycan anchor biosynthesis, class S 2 3
MIRT608316 SYK spleen associated tyrosine kinase 2 4
MIRT609794 PINX1 PIN2/TERF1 interacting telomerase inhibitor 1 2 2
MIRT609991 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 3
MIRT611381 PNMAL1 paraneoplastic Ma antigen family member 8A 2 4
MIRT613566 YY2 YY2 transcription factor 2 2
MIRT614612 MVK mevalonate kinase 2 2
MIRT615497 MPP2 membrane palmitoylated protein 2 2 2
MIRT616941 OTUD7A OTU deubiquitinase 7A 2 2
MIRT617576 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT618214 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 4
MIRT619885 ABHD17B abhydrolase domain containing 17B 2 2
MIRT620401 MYO1H myosin IH 2 2
MIRT620517 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT622166 SMYD1 SET and MYND domain containing 1 2 2
MIRT623195 MTX3 metaxin 3 2 2
MIRT623440 KIAA0408 KIAA0408 2 4
MIRT624837 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT625706 SHROOM1 shroom family member 1 2 2
MIRT628159 HIP1 huntingtin interacting protein 1 2 2
MIRT629496 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT630240 SOGA3 SOGA family member 3 2 4
MIRT630521 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT635676 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637820 CACNA1B calcium voltage-gated channel subunit alpha1 B 2 2
MIRT637943 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT640490 EXOC5 exocyst complex component 5 2 2
MIRT642722 ATXN3 ataxin 3 2 2
MIRT649153 LRTM1 leucine rich repeats and transmembrane domains 1 2 2
MIRT649610 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT661016 ABCA12 ATP binding cassette subfamily A member 12 2 2
MIRT661055 RPL18A ribosomal protein L18a 2 2
MIRT684041 FOLR1 folate receptor 1 2 2
MIRT691014 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT698908 SPPL2A signal peptide peptidase like 2A 2 2
MIRT700981 PDE4D phosphodiesterase 4D 2 2
MIRT701722 MTMR12 myotubularin related protein 12 2 2
MIRT702724 INSIG1 insulin induced gene 1 2 2
MIRT705057 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705216 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT706088 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT709458 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT711396 RANBP2 RAN binding protein 2 2 2
MIRT720573 SDHAF2 succinate dehydrogenase complex assembly factor 2 2 2
MIRT725366 MTF2 metal response element binding transcription factor 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-642b-3p Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-642b-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-642b-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-642b-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer cell line (ACHN, RCC23)
hsa-miR-642b-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (HEYA8)
hsa-miR-642b-3p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-642b-3p Platinum 23939 sensitive High High-Grade Serous Ovarian Cancer tissue
hsa-miR-642b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-642b-3p Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-642b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-642b-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-642b-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-642b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission