miRTarBase - #MIRT496148


—
pre-miRNA Information
pre-miRNA hsa-mir-1306   
Genomic Coordinates chr22: 20086058 - 20086142
Synonyms MIRN1306, hsa-mir-1306, MIR1306
Description Homo sapiens miR-1306 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1306-5p
Sequence 15| CCACCUCCCCUGCAAACGUCCA |36
Evidence Not_experimental
Experiments
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM5858927 8 COSMIC
COSM8222405 15 COSMIC
COSM1032175 17 COSMIC
COSM122562 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1197492175 14 dbSNP
rs1245517093 17 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GPS1   
Synonyms COPS1, CSN1, SGN1
Description G protein pathway suppressor 1
Transcript NM_004127   
Other Transcripts NM_212492   
Expression
Putative miRNA Targets on GPS1
3'UTR of GPS1
(miRNA target sites are highlighted)		 
>GPS1|NM_004127|3'UTR
   1 GGGGTGAACCTTGGCCTCCAGGACATCTGCACCCCCTCCCCACCTCCACGGACCTCGGACCTCCAGGCGGCTCAGTGCTG
  81 CCTGCGGCCCAGCTAAGGGGCCTGGCCACTGGGTGCCACCCAGCCTGTGTGCCCTCCCTGGGGCTGAGGAGGCAGGCGGC
 161 TGCTAGTTGTGGCCCTTCCTGGAAGGAGAGGCCTGCAGGGCTCGACCCTGTGGGTTTCTGTCCCCAGGGAGCAGACTGTG
 241 CGGCACCCAGGCCCAGTGGCACCATTTCCCAGACCCCTCCTGTTCCCGCCTCAGTCAGGTGCAGACAAGTGGGCGGTGTC
 321 CATTAAAGAGCAGACTCAGCGTTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' accugcaaACGUC------CCCUCCACc 5'
                  |||||      ||| |||| 
Target 5' cagtcaggTGCAGACAAGTGGGCGGTGt 3'
 292 - 319 120.00 -13.90
2 
miRNA  3' accugcaaaCGUCCCCUCCacc 5'
                   || | |||||   
Target 5' ctccctgggGCTGAGGAGGcag 3'
 134 - 155 109.00 -12.10
3 
miRNA  3' accugcaaacgucccCUCCACc 5'
                         |:|||| 
Target 5' ---------------GGGGTGa 3'
 1 - 7 104.00 -6.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30476736 2 COSMIC
COSN30523209 15 COSMIC
COSN24305993 22 COSMIC
COSN505936 37 COSMIC
COSN24034315 57 COSMIC
COSN13755347 58 COSMIC
COSN31556418 64 COSMIC
COSN26646699 65 COSMIC
COSN30535429 74 COSMIC
COSN30713175 79 COSMIC
COSN30182247 84 COSMIC
COSN26678630 88 COSMIC
COSN26636534 124 COSMIC
COSN30609352 139 COSMIC
COSN31578828 215 COSMIC
COSN15665798 224 COSMIC
COSN31561884 242 COSMIC
COSN31588918 289 COSMIC
COSN26637839 302 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1403609218 2 dbSNP
rs773849713 5 dbSNP
rs759173118 10 dbSNP
rs764779002 11 dbSNP
rs1174415373 17 dbSNP
rs1430122459 21 dbSNP
rs1296346105 22 dbSNP
rs752328214 23 dbSNP
rs762622123 25 dbSNP
rs1283088177 26 dbSNP
rs1343305167 27 dbSNP
rs1186481271 28 dbSNP
rs140755185 31 dbSNP
rs751301684 33 dbSNP
rs984435916 34 dbSNP
rs757193775 36 dbSNP
rs369830273 37 dbSNP
rs1264652350 39 dbSNP
rs1488606670 40 dbSNP
rs750349647 41 dbSNP
rs756198329 42 dbSNP
rs760497815 43 dbSNP
rs75363570 44 dbSNP
rs749504466 45 dbSNP
rs1442233984 48 dbSNP
rs57800087 50 dbSNP
rs779148528 51 dbSNP
rs1307900535 55 dbSNP
rs150111604 57 dbSNP
rs138450617 58 dbSNP
rs1356770986 62 dbSNP
rs184414541 64 dbSNP
rs769215319 65 dbSNP
rs1303059561 66 dbSNP
rs775020127 69 dbSNP
rs763739435 70 dbSNP
rs1463819658 71 dbSNP
rs1275766272 73 dbSNP
rs773990493 74 dbSNP
rs12841 83 dbSNP
rs761657065 86 dbSNP
rs767279761 87 dbSNP
rs750401131 90 dbSNP
rs111309938 91 dbSNP
rs766382520 95 dbSNP
rs926203424 96 dbSNP
rs936298385 100 dbSNP
rs753888910 101 dbSNP
rs563848936 102 dbSNP
rs779334656 104 dbSNP
rs946010907 106 dbSNP
rs1157075639 113 dbSNP
rs764051315 114 dbSNP
rs879464806 116 dbSNP
rs1162665697 119 dbSNP
rs1045834282 121 dbSNP
rs1389241489 122 dbSNP
rs758871614 124 dbSNP
rs1324682177 128 dbSNP
rs1335517983 130 dbSNP
rs1179222774 132 dbSNP
rs1444215699 132 dbSNP
rs1310986249 138 dbSNP
rs1250580223 139 dbSNP
rs778239246 139 dbSNP
rs1240186456 146 dbSNP
rs78625180 153 dbSNP
rs771415364 158 dbSNP
rs774871104 159 dbSNP
rs1232142994 161 dbSNP
rs749957833 167 dbSNP
rs1210327320 168 dbSNP
rs1272110564 171 dbSNP
rs1456266762 174 dbSNP
rs1338230321 176 dbSNP
rs947859568 176 dbSNP
rs570009667 177 dbSNP
rs1240264340 179 dbSNP
rs1374430956 182 dbSNP
rs1046582958 185 dbSNP
rs1440507602 187 dbSNP
rs1186955738 188 dbSNP
rs1397324300 189 dbSNP
rs761612913 192 dbSNP
rs765850933 192 dbSNP
rs1459937137 193 dbSNP
rs1164343007 197 dbSNP
rs1400102861 198 dbSNP
rs1366821025 199 dbSNP
rs1464407615 200 dbSNP
rs1033546082 203 dbSNP
rs768040376 204 dbSNP
rs774041060 205 dbSNP
rs1310019746 209 dbSNP
rs1469701064 214 dbSNP
rs1341736883 220 dbSNP
rs1245503778 221 dbSNP
rs761425733 224 dbSNP
rs10013 226 dbSNP
rs1017250004 228 dbSNP
rs1213038380 230 dbSNP
rs961084048 233 dbSNP
rs751103779 237 dbSNP
rs537465571 239 dbSNP
rs1458418579 241 dbSNP
rs994212437 242 dbSNP
rs555445570 243 dbSNP
rs766405936 247 dbSNP
rs1188270419 250 dbSNP
rs1174465064 251 dbSNP
rs955161426 256 dbSNP
rs985175392 263 dbSNP
rs911416337 265 dbSNP
rs1018086001 268 dbSNP
rs1477106444 271 dbSNP
rs1454425486 274 dbSNP
rs919993560 274 dbSNP
rs765351326 275 dbSNP
rs957523289 276 dbSNP
rs990430814 278 dbSNP
rs1447394647 280 dbSNP
rs753704934 281 dbSNP
rs976840976 285 dbSNP
rs1403827817 288 dbSNP
rs755133243 289 dbSNP
rs1449809087 290 dbSNP
rs967372961 291 dbSNP
rs1328845123 292 dbSNP
rs1338360648 300 dbSNP
rs1283411726 302 dbSNP
rs765374367 303 dbSNP
rs1046110129 304 dbSNP
rs752995777 307 dbSNP
rs977456676 308 dbSNP
rs1232889161 313 dbSNP
rs1254500296 315 dbSNP
rs1484322784 316 dbSNP
rs866310333 317 dbSNP
rs563587647 320 dbSNP
rs1320682454 321 dbSNP
rs750469449 322 dbSNP
rs1196432695 323 dbSNP
rs1424861294 329 dbSNP
rs937446842 332 dbSNP
rs1436847487 334 dbSNP
rs1432981403 336 dbSNP
rs1375776952 340 dbSNP
rs117705554 341 dbSNP
rs778300415 342 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL-BACD1
Disease MIMAT0022726
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020024. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' accugcaaacGUCCCCUCCACc 5'
                    :|||||||||| 
Target 5' -------gccUAGGGGAGGUGg 3'
 		1 - 15
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020024
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL-BACD1 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000578552.1 | 3UTR | GCCUAGGGGAGGUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-1306-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT089458 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT167143 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT290873 BCL10 B-cell CLL/lymphoma 10 2 2
MIRT320237 CYCS cytochrome c, somatic 2 2
MIRT462980 ZNF784 zinc finger protein 784 2 2
MIRT478039 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT479102 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT482763 TMEM126B transmembrane protein 126B 2 2
MIRT489972 MCC mutated in colorectal cancers 2 4
MIRT495484 TNFAIP2 TNF alpha induced protein 2 2 2
MIRT496148 GPS1 G protein pathway suppressor 1 2 2
MIRT523370 GSR glutathione-disulfide reductase 2 2
MIRT526299 SORCS2 sortilin related VPS10 domain containing receptor 2 2 4
MIRT527427 NRL neural retina leucine zipper 2 2
MIRT527860 SMOC1 SPARC related modular calcium binding 1 2 6
MIRT529685 FBXL19 F-box and leucine rich repeat protein 19 2 2
MIRT531526 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT532461 PLGRKT plasminogen receptor with a C-terminal lysine 2 2
MIRT532519 KCNN1 potassium calcium-activated channel subfamily N member 1 2 2
MIRT532668 APOBEC3D apolipoprotein B mRNA editing enzyme catalytic subunit 3D 2 2
MIRT532718 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT533205 WAPAL WAPL cohesin release factor 2 2
MIRT536480 KIAA1549 KIAA1549 2 2
MIRT537158 GID8 GID complex subunit 8 homolog 2 2
MIRT539307 AKIRIN1 akirin 1 2 2
MIRT539569 CNKSR3 CNKSR family member 3 2 4
MIRT540045 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT540235 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT543016 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT551436 F2 coagulation factor II, thrombin 2 2
MIRT556146 MED12L mediator complex subunit 12 like 2 2
MIRT570714 DGKE diacylglycerol kinase epsilon 2 2
MIRT572037 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT572409 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT572660 AGMAT agmatinase 2 4
MIRT611450 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT611601 JAKMIP3 Janus kinase and microtubule interacting protein 3 2 4
MIRT612208 TMEM109 transmembrane protein 109 2 2
MIRT612312 VSIG10 V-set and immunoglobulin domain containing 10 2 2
MIRT614146 MAFK MAF bZIP transcription factor K 2 2
MIRT617371 C21orf62 chromosome 21 open reading frame 62 2 2
MIRT617689 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT618495 DENND5B DENN domain containing 5B 2 4
MIRT618802 SPATA21 spermatogenesis associated 21 2 2
MIRT619061 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT619902 NPTXR neuronal pentraxin receptor 2 2
MIRT620080 DZIP1L DAZ interacting zinc finger protein 1 like 2 2
MIRT622233 SLC25A45 solute carrier family 25 member 45 2 2
MIRT625262 ZNF566 zinc finger protein 566 2 2
MIRT625725 CXorf38 chromosome X open reading frame 38 2 2
MIRT625813 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT625839 NXPE2 neurexophilin and PC-esterase domain family member 2 2 2
MIRT626024 XRCC2 X-ray repair cross complementing 2 2 2
MIRT626054 PDE4C phosphodiesterase 4C 2 2
MIRT626082 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT626356 PACS1 phosphofurin acidic cluster sorting protein 1 2 2
MIRT626790 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT627797 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT628234 FAM212B family with sequence similarity 212 member B 2 2
MIRT628241 FADS1 fatty acid desaturase 1 2 2
MIRT628249 ETF1 eukaryotic translation termination factor 1 2 2
MIRT628799 A2ML1 alpha-2-macroglobulin like 1 2 2
MIRT628879 FAM177A1 family with sequence similarity 177 member A1 2 4
MIRT629333 ZNF487P zinc finger protein 487 1 1
MIRT629435 RPL34 ribosomal protein L34 2 2
MIRT629977 MRPL36 mitochondrial ribosomal protein L36 2 2
MIRT630727 FPR1 formyl peptide receptor 1 2 2
MIRT630776 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT631074 ZNF829 zinc finger protein 829 2 2
MIRT633139 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT633178 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT633510 RNF14 ring finger protein 14 2 2
MIRT633613 APCDD1 APC down-regulated 1 2 2
MIRT633668 MYO1F myosin IF 2 2
MIRT633707 LRRC8B leucine rich repeat containing 8 VRAC subunit B 2 2
MIRT633798 SOX7 SRY-box 7 2 2
MIRT634203 TMOD2 tropomodulin 2 2 4
MIRT634297 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT634509 NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 2 2
MIRT634518 NKAP NFKB activating protein 2 2
MIRT634754 CRCP CGRP receptor component 2 2
MIRT635741 IFNAR1 interferon alpha and beta receptor subunit 1 2 2
MIRT636480 KLHL7 kelch like family member 7 2 2
MIRT637042 FITM2 fat storage inducing transmembrane protein 2 2 2
MIRT637748 POLR3K RNA polymerase III subunit K 2 2
MIRT638568 IFNE interferon epsilon 2 2
MIRT639155 TMEM167A transmembrane protein 167A 2 2
MIRT639848 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT641770 ZNF207 zinc finger protein 207 2 2
MIRT642285 ZNF99 zinc finger protein 99 2 2
MIRT642685 KRT74 keratin 74 2 2
MIRT643530 ERAP2 endoplasmic reticulum aminopeptidase 2 2 2
MIRT643742 ZNF284 zinc finger protein 284 2 4
MIRT643945 WIPF3 WAS/WASL interacting protein family member 3 2 2
MIRT644320 NFKBID NFKB inhibitor delta 2 2
MIRT644383 ZNF286A zinc finger protein 286A 2 2
MIRT645130 HES2 hes family bHLH transcription factor 2 2 2
MIRT645607 PCDH11X protocadherin 11 X-linked 2 2
MIRT647121 ZNF446 zinc finger protein 446 2 2
MIRT648484 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT648549 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT649252 TRIM65 tripartite motif containing 65 2 2
MIRT649468 SLC10A7 solute carrier family 10 member 7 2 2
MIRT650013 KLB klotho beta 2 2
MIRT650068 CCDC134 coiled-coil domain containing 134 2 2
MIRT650325 RTN2 reticulon 2 2 2
MIRT651093 ZNF516 zinc finger protein 516 2 2
MIRT651265 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 2 2
MIRT651272 ZKSCAN1 zinc finger with KRAB and SCAN domains 1 2 2
MIRT651402 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT652163 TRIM66 tripartite motif containing 66 2 2
MIRT653153 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 2
MIRT653477 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT653922 SERPINC1 serpin family C member 1 2 2
MIRT654243 RNF115 ring finger protein 115 2 2
MIRT655354 PCDH11Y protocadherin 11 Y-linked 2 2
MIRT655958 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT656318 MESDC1 talin rod domain containing 1 2 2
MIRT656578 LSM10 LSM10, U7 small nuclear RNA associated 2 2
MIRT657210 IKZF2 IKAROS family zinc finger 2 2 2
MIRT657856 GJB1 gap junction protein beta 1 2 2
MIRT658207 FBXO44 F-box protein 44 2 2
MIRT659003 DIAPH1 diaphanous related formin 1 2 2
MIRT659349 CSRP1 cysteine and glycine rich protein 1 2 2
MIRT659501 CISD3 CDGSH iron sulfur domain 3 2 2
MIRT659761 CCDC171 coiled-coil domain containing 171 2 2
MIRT660149 BRD4 bromodomain containing 4 2 2
MIRT661582 EPHX2 epoxide hydrolase 2 2 2
MIRT661753 ATM ATM serine/threonine kinase 2 2
MIRT662223 CCRL2 C-C motif chemokine receptor like 2 2 2
MIRT663883 CXorf56 chromosome X open reading frame 56 2 2
MIRT664308 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT664649 GALM galactose mutarotase 2 2
MIRT664671 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 2
MIRT665050 C3 complement C3 2 2
MIRT666467 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT666529 RNF170 ring finger protein 170 2 2
MIRT669118 CDC42BPG CDC42 binding protein kinase gamma 2 2
MIRT669311 C17orf75 chromosome 17 open reading frame 75 2 2
MIRT669358 BHLHE22 basic helix-loop-helix family member e22 2 2
MIRT669691 ABLIM1 actin binding LIM protein 1 2 2
MIRT674223 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674766 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 2 2
MIRT675207 ZNF554 zinc finger protein 554 2 2
MIRT675271 ZNF431 zinc finger protein 431 2 2
MIRT676265 PBOV1 prostate and breast cancer overexpressed 1 2 2
MIRT676573 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT677566 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT677631 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT678115 MICA MHC class I polypeptide-related sequence A 2 2
MIRT678694 RNF157 ring finger protein 157 2 2
MIRT679583 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT679621 MED28 mediator complex subunit 28 2 2
MIRT683700 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT683721 LACTB lactamase beta 2 2
MIRT690967 APOL1 apolipoprotein L1 2 2
MIRT691611 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT702524 KCND3 potassium voltage-gated channel subfamily D member 3 2 2
MIRT704762 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT708738 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT708898 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT709965 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT710373 GM2A GM2 ganglioside activator 2 2
MIRT710533 TMEM201 transmembrane protein 201 2 2
MIRT710582 HLCS holocarboxylase synthetase 2 2
MIRT711030 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT712200 SHROOM4 shroom family member 4 2 2
MIRT713798 CPLX2 complexin 2 2 2
MIRT714096 ZNF486 zinc finger protein 486 2 2
MIRT714923 PPP1R12C protein phosphatase 1 regulatory subunit 12C 2 2
MIRT716518 TNPO2 transportin 2 2 2
MIRT716701 HLA-B major histocompatibility complex, class I, B 2 2
MIRT717070 MTMR6 myotubularin related protein 6 2 2
MIRT719561 CBL Cbl proto-oncogene 2 2
MIRT719688 ALDH1L2 aldehyde dehydrogenase 1 family member L2 2 2
MIRT720134 RIMKLA ribosomal modification protein rimK like family member A 2 2
MIRT720222 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT720982 METTL21A methyltransferase like 21A 2 2
MIRT723821 PDS5A PDS5 cohesin associated factor A 2 2
MIRT723999 LMTK2 lemur tyrosine kinase 2 2 2
MIRT724963 PTK6 protein tyrosine kinase 6 2 2
MIRT725217 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT725262 PARVB parvin beta 2 2
MIRT755883 METTL14 methyltransferase like 14 3 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1306 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-1306 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-miR-1306-5p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-miR-1306-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-1306-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1306-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1306-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission