pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3119-1 |
Genomic Coordinates | chr1: 170151378 - 170151462 |
Description | Homo sapiens miR-3119-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
pre-miRNA | hsa-mir-3119-2 |
Genomic Coordinates | chr1: 170151378 - 170151462 |
Description | Homo sapiens miR-3119-2 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3119 | ||||||||||||||||||||||||||||||
Sequence | 9| UGGCUUUUAACUUUGAUGGC |28 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RPS15A | ||||||||||
Synonyms | S15a | ||||||||||
Description | ribosomal protein S15a | ||||||||||
Transcript | NM_001019 | ||||||||||
Other Transcripts | NM_001030009 | ||||||||||
Expression | |||||||||||
Putative miRNA Targets on RPS15A | |||||||||||
3'UTR of RPS15A (miRNA target sites are highlighted) |
>RPS15A|NM_001019|3'UTR 1 GGATGTAATACATATATTTACAAATAAAATGCCTCATGGACTCTGGTGCTTCCAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||
DRVs in gene 3'UTRs | |||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | LCL-BACD1 | ||||||
Disease | MIMAT0014981 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1020024. RNA binding protein: AGO2. Condition:EBV B95-8-infected
... - Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Skalsky RL; Corcoran DL; Gottwein E; Frank et al. - PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
|
CLIP-seq Support 1 for dataset GSM1020024 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | LCL-BACD1 / EBV B95-8-infected, 4-thiouridine, RNase T1 |
Location of target site | ENST00000576436.1 | 3UTR | GCCUAUCUGAGUUCAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22291592 / GSE41437 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-3119 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT130164 | TXNIP | thioredoxin interacting protein | 2 | 4 | ||||||||
MIRT364023 | SDCBP | syndecan binding protein | 2 | 2 | ||||||||
MIRT383920 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT397609 | RACGAP1 | Rac GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT404072 | ZBTB21 | zinc finger and BTB domain containing 21 | 2 | 2 | ||||||||
MIRT443202 | ECHDC3 | enoyl-CoA hydratase domain containing 3 | 2 | 2 | ||||||||
MIRT446469 | THUMPD3 | THUMP domain containing 3 | 2 | 2 | ||||||||
MIRT446489 | PRELP | proline and arginine rich end leucine rich repeat protein | 2 | 2 | ||||||||
MIRT446849 | FIBIN | fin bud initiation factor homolog (zebrafish) | 2 | 2 | ||||||||
MIRT463282 | ZFX | zinc finger protein, X-linked | 2 | 4 | ||||||||
MIRT478441 | DAZAP2 | DAZ associated protein 2 | 2 | 2 | ||||||||
MIRT480447 | C16orf72 | chromosome 16 open reading frame 72 | 2 | 2 | ||||||||
MIRT480632 | BTBD3 | BTB domain containing 3 | 2 | 6 | ||||||||
MIRT487460 | ANKRD42 | ankyrin repeat domain 42 | 2 | 2 | ||||||||
MIRT487497 | IL1F10 | interleukin 1 family member 10 | 2 | 4 | ||||||||
MIRT491967 | USP37 | ubiquitin specific peptidase 37 | 2 | 2 | ||||||||
MIRT495620 | PPP1R1C | protein phosphatase 1 regulatory inhibitor subunit 1C | 2 | 2 | ||||||||
MIRT496151 | RPS15A | ribosomal protein S15a | 2 | 2 | ||||||||
MIRT498042 | SNX5 | sorting nexin 5 | 2 | 6 | ||||||||
MIRT500546 | XBP1P1 | X-box binding protein 1 pseudogene 1 | 2 | 8 | ||||||||
MIRT503902 | ZSCAN25 | zinc finger and SCAN domain containing 25 | 2 | 2 | ||||||||
MIRT513157 | BIRC5 | baculoviral IAP repeat containing 5 | 2 | 6 | ||||||||
MIRT519070 | KCNK6 | potassium two pore domain channel subfamily K member 6 | 2 | 2 | ||||||||
MIRT519741 | ZNF394 | zinc finger protein 394 | 2 | 4 | ||||||||
MIRT522733 | LRP8 | LDL receptor related protein 8 | 2 | 4 | ||||||||
MIRT539402 | ADIPOR2 | adiponectin receptor 2 | 2 | 2 | ||||||||
MIRT551660 | KIAA1143 | KIAA1143 | 2 | 4 | ||||||||
MIRT559131 | BTG3 | BTG anti-proliferation factor 3 | 2 | 4 | ||||||||
MIRT559307 | ATXN1 | ataxin 1 | 2 | 2 | ||||||||
MIRT559515 | ARHGEF26 | Rho guanine nucleotide exchange factor 26 | 2 | 2 | ||||||||
MIRT560771 | RRP7A | ribosomal RNA processing 7 homolog A | 2 | 2 | ||||||||
MIRT562210 | HMGB2 | high mobility group box 2 | 2 | 2 | ||||||||
MIRT562734 | ZNF468 | zinc finger protein 468 | 2 | 2 | ||||||||
MIRT563070 | EMC8 | ER membrane protein complex subunit 8 | 2 | 2 | ||||||||
MIRT563731 | ZNF107 | zinc finger protein 107 | 2 | 4 | ||||||||
MIRT576719 | Wars | tryptophanyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT612872 | IGFBP5 | insulin like growth factor binding protein 5 | 2 | 4 | ||||||||
MIRT613214 | CCDC85C | coiled-coil domain containing 85C | 2 | 4 | ||||||||
MIRT613591 | THSD7A | thrombospondin type 1 domain containing 7A | 2 | 2 | ||||||||
MIRT614332 | NANOS1 | nanos C2HC-type zinc finger 1 | 2 | 4 | ||||||||
MIRT614929 | MARCH3 | membrane associated ring-CH-type finger 3 | 2 | 2 | ||||||||
MIRT616257 | KANK4 | KN motif and ankyrin repeat domains 4 | 2 | 2 | ||||||||
MIRT617087 | FPR1 | formyl peptide receptor 1 | 2 | 2 | ||||||||
MIRT617167 | SLC16A5 | solute carrier family 16 member 5 | 2 | 2 | ||||||||
MIRT620350 | WDR75 | WD repeat domain 75 | 2 | 2 | ||||||||
MIRT621041 | SOX30 | SRY-box 30 | 2 | 2 | ||||||||
MIRT625936 | SCYL3 | SCY1 like pseudokinase 3 | 2 | 2 | ||||||||
MIRT636872 | BCORL1 | BCL6 corepressor like 1 | 2 | 2 | ||||||||
MIRT637019 | CLASP1 | cytoplasmic linker associated protein 1 | 2 | 2 | ||||||||
MIRT637299 | ACTN2 | actinin alpha 2 | 2 | 2 | ||||||||
MIRT639734 | MAP2K2 | mitogen-activated protein kinase kinase 2 | 2 | 2 | ||||||||
MIRT640811 | ZMAT1 | zinc finger matrin-type 1 | 2 | 2 | ||||||||
MIRT642879 | SAMD1 | sterile alpha motif domain containing 1 | 2 | 2 | ||||||||
MIRT648116 | ADAT1 | adenosine deaminase, tRNA specific 1 | 2 | 2 | ||||||||
MIRT655769 | NPTX1 | neuronal pentraxin 1 | 2 | 2 | ||||||||
MIRT655801 | NOVA2 | NOVA alternative splicing regulator 2 | 2 | 2 | ||||||||
MIRT659142 | DDR2 | discoidin domain receptor tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT660327 | BCL11B | B-cell CLL/lymphoma 11B | 2 | 2 | ||||||||
MIRT662150 | IPO11 | importin 11 | 2 | 2 | ||||||||
MIRT664741 | METTL16 | methyltransferase like 16 | 2 | 2 | ||||||||
MIRT670134 | HOXD12 | homeobox D12 | 2 | 2 | ||||||||
MIRT679027 | ZNF419 | zinc finger protein 419 | 2 | 2 | ||||||||
MIRT695596 | TMEM199 | transmembrane protein 199 | 2 | 2 | ||||||||
MIRT703345 | GATAD2B | GATA zinc finger domain containing 2B | 2 | 2 | ||||||||
MIRT704097 | DST | dystonin | 2 | 2 | ||||||||
MIRT711833 | AMOTL2 | angiomotin like 2 | 2 | 2 | ||||||||
MIRT715820 | ZNF598 | zinc finger protein 598 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|