pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-5590 |
Genomic Coordinates | chr2: 134857820 - 134857873 |
Description | Homo sapiens miR-5590 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-5590-5p | |||||||||||||||||||||||||||
Sequence | 1| UUGCCAUACAUAGACUUUAUU |21 | |||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TMEM81 | ||||||||||||||||||||
Synonyms | HC3107, KVLA2788, UNQ2788 | ||||||||||||||||||||
Description | transmembrane protein 81 | ||||||||||||||||||||
Transcript | NM_203376 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TMEM81 | |||||||||||||||||||||
3'UTR of TMEM81 (miRNA target sites are highlighted) |
>TMEM81|NM_203376|3'UTR 1 CAGCTTCAAGAACTTAACAGCCTTGCTCCTGAAGAACTGGCTGCCCAGGAAGCCAAGCTAGCTTTTTAGGGGAGTGTTCC 81 AGCTGCTGGTAGTGGATCAGCTTAGAGGGAACACTCCCACAGCCAAAAGAATGAGTGGGAGAAATGGAGGGGACAATCTC 161 CTGGGAGCTATGCGCAGTAACCTAACTTCCTTATGTCCCATGGATCTCTTCCTGATCTTCCCTGCCCATTGGGTACCCAG 241 GAAACTGCAAGCATTGCCTGTGTTCCTGGGAAGAGTTCTAAGAAGCTTGCATTCATTTTCTACCCTTTATGACTTGGATG 321 CCTCCCCACCTCCATTTCCCCTCTTCTGAGCTGTGTATTCATGTAGAGGGATGTATTCAGCCTTTTTAGTGAACATTTTT 401 TTTCAATAAAAGTAATTCACAGTAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | LCL-BACD1 | ||||||
Disease | MIMAT0022299 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1020024. RNA binding protein: AGO2. Condition:EBV B95-8-infected
... - Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Skalsky RL; Corcoran DL; Gottwein E; Frank et al. - PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
|
CLIP-seq Support 1 for dataset GSM1020024 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | LCL-BACD1 / EBV B95-8-infected, 4-thiouridine, RNase T1 |
Location of target site | ENST00000367167.3 | 3UTR | GCCUAUGGCAGGGGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22291592 / GSE41437 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
69 hsa-miR-5590-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT056313 | WAC | WW domain containing adaptor with coiled-coil | 2 | 6 | ||||||||
MIRT066181 | PIP4K2C | phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | 2 | 2 | ||||||||
MIRT095612 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | 2 | 2 | ||||||||
MIRT099166 | MYLIP | myosin regulatory light chain interacting protein | 2 | 2 | ||||||||
MIRT107578 | VLDLR | very low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT179602 | CAPZA1 | capping actin protein of muscle Z-line alpha subunit 1 | 2 | 8 | ||||||||
MIRT241303 | ZC3H12C | zinc finger CCCH-type containing 12C | 2 | 8 | ||||||||
MIRT244620 | MCM4 | minichromosome maintenance complex component 4 | 2 | 2 | ||||||||
MIRT270705 | SBNO1 | strawberry notch homolog 1 | 2 | 4 | ||||||||
MIRT453616 | SNRPE | small nuclear ribonucleoprotein polypeptide E | 2 | 4 | ||||||||
MIRT453653 | RAB6C | RAB6C, member RAS oncogene family | 2 | 2 | ||||||||
MIRT464159 | VMP1 | vacuole membrane protein 1 | 2 | 15 | ||||||||
MIRT477720 | EEF1A1 | eukaryotic translation elongation factor 1 alpha 1 | 2 | 2 | ||||||||
MIRT484301 | ENDOD1 | endonuclease domain containing 1 | 2 | 4 | ||||||||
MIRT496069 | GLCCI1 | glucocorticoid induced 1 | 2 | 2 | ||||||||
MIRT496338 | TMEM81 | transmembrane protein 81 | 2 | 2 | ||||||||
MIRT496653 | PITPNM3 | PITPNM family member 3 | 2 | 2 | ||||||||
MIRT499098 | DENND4C | DENN domain containing 4C | 2 | 8 | ||||||||
MIRT499862 | SVOP | SV2 related protein | 2 | 12 | ||||||||
MIRT504913 | CD38 | CD38 molecule | 2 | 4 | ||||||||
MIRT515401 | WDR72 | WD repeat domain 72 | 2 | 4 | ||||||||
MIRT518156 | TMEM133 | transmembrane protein 133 | 2 | 2 | ||||||||
MIRT518558 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | 2 | 2 | ||||||||
MIRT518636 | NOM1 | nucleolar protein with MIF4G domain 1 | 2 | 2 | ||||||||
MIRT518724 | ABCG8 | ATP binding cassette subfamily G member 8 | 2 | 2 | ||||||||
MIRT524301 | CTC1 | CST telomere replication complex component 1 | 2 | 4 | ||||||||
MIRT524472 | CHRM3 | cholinergic receptor muscarinic 3 | 2 | 4 | ||||||||
MIRT527562 | ADCY7 | adenylate cyclase 7 | 2 | 2 | ||||||||
MIRT532694 | TCN2 | transcobalamin 2 | 2 | 4 | ||||||||
MIRT534640 | RNF6 | ring finger protein 6 | 2 | 2 | ||||||||
MIRT537163 | GGCX | gamma-glutamyl carboxylase | 2 | 2 | ||||||||
MIRT539360 | AFF4 | AF4/FMR2 family member 4 | 2 | 2 | ||||||||
MIRT547023 | PPP1CB | protein phosphatase 1 catalytic subunit beta | 2 | 2 | ||||||||
MIRT548155 | FRAT2 | FRAT2, WNT signaling pathway regulator | 2 | 2 | ||||||||
MIRT550127 | ZNF138 | zinc finger protein 138 | 2 | 2 | ||||||||
MIRT558473 | DBN1 | drebrin 1 | 2 | 2 | ||||||||
MIRT566862 | LRRC58 | leucine rich repeat containing 58 | 2 | 2 | ||||||||
MIRT567246 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | 2 | 2 | ||||||||
MIRT572848 | BRPF3 | bromodomain and PHD finger containing 3 | 2 | 2 | ||||||||
MIRT574914 | Vmp1 | vacuole membrane protein 1 | 2 | 9 | ||||||||
MIRT606849 | RAB7A | RAB7A, member RAS oncogene family | 2 | 2 | ||||||||
MIRT611274 | RBMXL1 | RNA binding motif protein, X-linked like 1 | 2 | 2 | ||||||||
MIRT612328 | TRPS1 | transcriptional repressor GATA binding 1 | 2 | 2 | ||||||||
MIRT612415 | SP1 | Sp1 transcription factor | 2 | 2 | ||||||||
MIRT614791 | RRAGC | Ras related GTP binding C | 2 | 2 | ||||||||
MIRT618449 | SERPINA3 | serpin family A member 3 | 2 | 2 | ||||||||
MIRT621154 | MICALCL | MICAL C-terminal like | 2 | 2 | ||||||||
MIRT622141 | SOX4 | SRY-box 4 | 2 | 2 | ||||||||
MIRT623504 | KCNK5 | potassium two pore domain channel subfamily K member 5 | 2 | 2 | ||||||||
MIRT623598 | IPO9 | importin 9 | 2 | 2 | ||||||||
MIRT624075 | EBF1 | early B-cell factor 1 | 2 | 2 | ||||||||
MIRT639792 | MVK | mevalonate kinase | 2 | 2 | ||||||||
MIRT641109 | ZNF274 | zinc finger protein 274 | 2 | 2 | ||||||||
MIRT641579 | RFX1 | regulatory factor X1 | 2 | 2 | ||||||||
MIRT643095 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | 2 | 2 | ||||||||
MIRT645141 | CUBN | cubilin | 2 | 2 | ||||||||
MIRT646461 | PRDM10 | PR/SET domain 10 | 2 | 2 | ||||||||
MIRT650815 | HMOX1 | heme oxygenase 1 | 2 | 2 | ||||||||
MIRT653073 | ST8SIA4 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 | 2 | 2 | ||||||||
MIRT657675 | GPR26 | G protein-coupled receptor 26 | 2 | 2 | ||||||||
MIRT665824 | TIMM8B | translocase of inner mitochondrial membrane 8 homolog B | 2 | 2 | ||||||||
MIRT695592 | TMEM199 | transmembrane protein 199 | 2 | 2 | ||||||||
MIRT698039 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | 2 | 2 | ||||||||
MIRT701015 | PCGF5 | polycomb group ring finger 5 | 2 | 2 | ||||||||
MIRT701357 | NR4A3 | nuclear receptor subfamily 4 group A member 3 | 2 | 2 | ||||||||
MIRT707114 | NWD1 | NACHT and WD repeat domain containing 1 | 2 | 2 | ||||||||
MIRT718661 | HNF4A | hepatocyte nuclear factor 4 alpha | 2 | 2 | ||||||||
MIRT719901 | SERP1 | stress associated endoplasmic reticulum protein 1 | 2 | 2 | ||||||||
MIRT720564 | C1RL | complement C1r subcomponent like | 2 | 2 |