pre-miRNA Information
pre-miRNA hsa-mir-3622a   
Genomic Coordinates chr8: 27701677 - 27701759
Description Homo sapiens miR-3622a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3622a-5p
Sequence 14| CAGGCACGGGAGCUCAGGUGAG |35
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 8 + 27701691 29233923 MiREDiBase
A-to-I 6 8 + 27701695 29233923 MiREDiBase
A-to-I 16 8 + 27701705 28550310, 29233923 MiREDiBase
A-to-I 21 8 + 27701710 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551845360 1 dbSNP
rs946438979 3 dbSNP
rs1044808718 7 dbSNP
rs66683138 8 dbSNP
rs1157333896 10 dbSNP
rs1439657384 12 dbSNP
rs530939348 17 dbSNP
rs1232922758 20 dbSNP
rs1448152954 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CECR1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0018003
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gagUGGACUCGAGGGCacggac 5'
             | | || :||:||      
Target 5' ucaAGCGGA-UUCUCG------ 3'
1 - 15
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_177405 | 3UTR | CUCGUGCCUCAGCCUCCUGAGUAGCUGGGAUUACAGGCAUGCACCACCAUGCCCGGAUAAUUUUUGUAUUUUUAGUAGAGAUGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000399839.1 | 3UTR | UCAAGCGGAUUCUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
THCA -0.008 0.49 0.048 0.46 8 Click to see details
61 hsa-miR-3622a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT166678 ZSWIM6 zinc finger SWIM-type containing 6 2 2
MIRT452081 ATP6V0B ATPase H+ transporting V0 subunit b 2 2
MIRT457039 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT471975 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT474065 LMNB2 lamin B2 2 2
MIRT475862 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT476191 GOLGA8A golgin A8 family member A 2 2
MIRT476521 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT483046 C15orf52 chromosome 15 open reading frame 52 2 4
MIRT495541 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT495892 CLOCK clock circadian regulator 2 2
MIRT495992 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT496001 EMP1 epithelial membrane protein 1 2 2
MIRT496208 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT496427 ACTRT3 actin related protein T3 2 2
MIRT496438 ZNF704 zinc finger protein 704 2 2
MIRT496473 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT496555 TBX15 T-box 15 2 2
MIRT497202 CECR1 adenosine deaminase 2 2 2
MIRT507632 CREBZF CREB/ATF bZIP transcription factor 2 2
MIRT513377 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A 2 2
MIRT523460 GOLGA8J golgin A8 family member J 2 2
MIRT523465 GOLGA8I golgin A8 family member I, pseudogene 1 1
MIRT526049 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT533122 YIPF4 Yip1 domain family member 4 2 2
MIRT534183 SLC8A1 solute carrier family 8 member A1 2 2
MIRT556618 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT563361 WHSC1 nuclear receptor binding SET domain protein 2 2 2
MIRT563868 FAM206A family with sequence similarity 206 member A 2 2
MIRT564360 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 2
MIRT564661 ZNF449 zinc finger protein 449 2 2
MIRT564805 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT564867 ZBED3 zinc finger BED-type containing 3 2 2
MIRT565340 TMEM104 transmembrane protein 104 2 2
MIRT566439 PHF16 jade family PHD finger 3 2 2
MIRT567587 FCHSD2 FCH and double SH3 domains 2 2 2
MIRT569597 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT569700 FMNL3 formin like 3 2 2
MIRT575957 Nanos1 nanos homolog 1 (Drosophila) 2 3
MIRT576516 Slc35e2 solute carrier family 35, member E2 2 2
MIRT608480 RRP36 ribosomal RNA processing 36 2 2
MIRT614335 NANOS1 nanos C2HC-type zinc finger 1 2 3
MIRT630816 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT631708 C1QTNF6 C1q and TNF related 6 2 2
MIRT632369 SRRD SRR1 domain containing 2 2
MIRT633471 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT634478 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT667336 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT667654 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT671046 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT672823 VEZT vezatin, adherens junctions transmembrane protein 2 2
MIRT673049 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT673435 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT676096 DPP9 dipeptidyl peptidase 9 2 2
MIRT678059 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT679783 GOLGA2 golgin A2 2 2
MIRT684219 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT697642 WRN Werner syndrome RecQ like helicase 2 2
MIRT706595 C1RL complement C1r subcomponent like 2 2
MIRT706603 CCS copper chaperone for superoxide dismutase 2 2
MIRT717647 HLX H2.0 like homeobox 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3622a Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-mir-3622a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-miR-3622a-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3622a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3622a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR3)
hsa-miR-3622a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission