miRTarBase - #MIRT497344


—
pre-miRNA Information
pre-miRNA hsa-mir-6715b   
Genomic Coordinates chr10: 112299612 - 112299688
Description Homo sapiens miR-6715b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6715b-3p
Sequence 46| CUCAAACCGGCUGUGCCUGUGG |67
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs761643095 7 dbSNP
rs768295556 8 dbSNP
rs182337914 9 dbSNP
rs1369684979 11 dbSNP
rs776704371 13 dbSNP
rs1039819520 15 dbSNP
rs771110697 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RPP25L   
Synonyms C9orf23, bA296L22.5
Description ribonuclease P/MRP subunit p25 like
Transcript NM_148178   
Other Transcripts NM_148179   
Expression
Putative miRNA Targets on RPP25L
3'UTR of RPP25L
(miRNA target sites are highlighted)		 
>RPP25L|NM_148178|3'UTR
   1 AGACCTGCTGAGCCAGCCTGTTCTCCGGGCCTGAATGTCTGGGGTGCTTGTGCCTTTTCTGAGAAGCGTTGTGACTGCTC
  81 AACATCCCCATCAAGGTTTGAGTCCACAAAAGTGGACCTCCCTATCATGCTTCCCCTTCCCTCTAGCATGTGGGAAGGGA
 161 CTGCTGTGAAGAATGACAGATGTGGGGCCTCTGCCAAGTTCTGCATTGCTAAATAAGGGCTTCCTCTGCCTTCTACCTAC
 241 AGTGCATTTGAACTGCCTTCTGAAAGAGGTCCAGGGAGGGATTTAGGAAATAAAGTTTCTACCTATTTGATGAGCCTCTA
 321 AAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggUGUCCGUGUCG-GCCAAACUc 5'
            |||  | || |  ||||||| 
Target 5' caACATCCCCATCAAGGTTTGAg 3'
 80 - 102 152.00 -13.60
2 
miRNA  3' gguguccgugucggccAAACUc 5'
                          ||||| 
Target 5' ttctacctacagtgcaTTTGAa 3'
 231 - 252 100.00 -9.16
3 
miRNA  3' ggUGUCCGUGUC-GGCCAAACUc 5'
            :::|| | :| |:| | ||| 
Target 5' atGTGGGAAGGGACTGCTGTGAa 3'
 148 - 170 92.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31594123 16 COSMIC
COSN30449586 25 COSMIC
COSN30449520 26 COSMIC
COSN26441915 27 COSMIC
COSN20070574 36 COSMIC
COSN30521762 39 COSMIC
COSN31492111 55 COSMIC
COSN30447256 59 COSMIC
COSN26993281 67 COSMIC
COSN30100258 68 COSMIC
COSN31511812 86 COSMIC
COSN19623942 100 COSMIC
COSN31503094 105 COSMIC
COSN30508382 113 COSMIC
COSN30115179 198 COSMIC
COSN1378238 258 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs781711091 9 dbSNP
rs1157948976 12 dbSNP
rs1468329386 13 dbSNP
rs765398877 18 dbSNP
rs1364963927 20 dbSNP
rs201414818 26 dbSNP
rs771553331 27 dbSNP
rs1245599725 29 dbSNP
rs201551984 30 dbSNP
rs747293954 32 dbSNP
rs200473346 41 dbSNP
rs1202382788 42 dbSNP
rs113300465 43 dbSNP
rs979188496 46 dbSNP
rs1264219619 47 dbSNP
rs772508813 50 dbSNP
rs967750591 53 dbSNP
rs1004758818 63 dbSNP
rs191886856 66 dbSNP
rs988228219 67 dbSNP
rs1254683264 68 dbSNP
rs188294193 69 dbSNP
rs760823897 72 dbSNP
rs1169188093 76 dbSNP
rs200997220 77 dbSNP
rs1467057087 79 dbSNP
rs1029997803 80 dbSNP
rs576668507 82 dbSNP
rs1053875157 85 dbSNP
rs1206790721 86 dbSNP
rs996733589 87 dbSNP
rs1272969568 94 dbSNP
rs936420739 95 dbSNP
rs13339 100 dbSNP
rs1380571529 108 dbSNP
rs772203544 112 dbSNP
rs977553941 115 dbSNP
rs946250851 120 dbSNP
rs1016775795 127 dbSNP
rs545797580 137 dbSNP
rs1209159630 142 dbSNP
rs763409595 143 dbSNP
rs375082579 153 dbSNP
rs12003899 159 dbSNP
rs1185421674 166 dbSNP
rs1366485340 183 dbSNP
rs1291274068 188 dbSNP
rs183761743 194 dbSNP
rs1427839318 197 dbSNP
rs765858568 201 dbSNP
rs1469573188 204 dbSNP
rs1355017653 206 dbSNP
rs929301126 211 dbSNP
rs896451525 212 dbSNP
rs1167832503 213 dbSNP
rs1288358370 217 dbSNP
rs1368325276 224 dbSNP
rs1388616926 234 dbSNP
rs139964847 236 dbSNP
rs1344851339 240 dbSNP
rs1396590505 241 dbSNP
rs111664714 248 dbSNP
rs1314764348 250 dbSNP
rs926815700 258 dbSNP
rs1265672969 263 dbSNP
rs1432811881 268 dbSNP
rs1188980047 269 dbSNP
rs1265618621 270 dbSNP
rs979554587 273 dbSNP
rs1030599720 274 dbSNP
rs1481026748 275 dbSNP
rs1183332753 277 dbSNP
rs1414737066 295 dbSNP
rs1399335709 300 dbSNP
rs199952186 303 dbSNP
rs1158596217 305 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0025843
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gguguccgugucggCCAAACUc 5'
                        ||||||| 
Target 5' ----------ucaaGGUUUGAg 3'
 		1 - 12
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000378959.4 | 3UTR | UCAAGGUUUGAGUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-6715b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080245 SMAD4 SMAD family member 4 2 2
MIRT142553 TNRC6A trinucleotide repeat containing 6A 2 4
MIRT384667 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT446660 MXI1 MAX interactor 1, dimerization protein 2 4
MIRT463754 YTHDC1 YTH domain containing 1 2 2
MIRT476873 FEM1B fem-1 homolog B 2 2
MIRT478429 DAZAP2 DAZ associated protein 2 2 2
MIRT495237 SPRY3 sprouty RTK signaling antagonist 3 2 4
MIRT495945 ANKRD52 ankyrin repeat domain 52 2 2
MIRT497116 TYW3 tRNA-yW synthesizing protein 3 homolog 2 2
MIRT497344 RPP25L ribonuclease P/MRP subunit p25 like 2 2
MIRT498133 KLHL3 kelch like family member 3 2 2
MIRT502306 GNA13 G protein subunit alpha 13 2 2
MIRT510854 RAN RAN, member RAS oncogene family 2 8
MIRT513323 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 6
MIRT523995 DTX4 deltex E3 ubiquitin ligase 4 2 4
MIRT525837 FAR2 fatty acyl-CoA reductase 2 2 2
MIRT527506 MYD88 myeloid differentiation primary response 88 2 2
MIRT527668 CIT citron rho-interacting serine/threonine kinase 2 2
MIRT527996 NDNF neuron derived neurotrophic factor 2 2
MIRT528052 MRS2 MRS2, magnesium transporter 2 2
MIRT528257 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT529401 ICK intestinal cell kinase 2 2
MIRT529558 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT530323 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT532230 KLF2 Kruppel like factor 2 2 2
MIRT534220 SLC35G1 solute carrier family 35 member G1 2 2
MIRT536195 MAML2 mastermind like transcriptional coactivator 2 2 2
MIRT538093 DEPDC1 DEP domain containing 1 2 2
MIRT543159 GTF2A1 general transcription factor IIA subunit 1 2 2
MIRT545840 ZNF264 zinc finger protein 264 2 4
MIRT546401 SRP9 signal recognition particle 9 2 2
MIRT550643 SLC39A7 solute carrier family 39 member 7 2 2
MIRT558648 CNKSR3 CNKSR family member 3 2 2
MIRT562208 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT562886 NACA2 nascent polypeptide associated complex alpha subunit 2 2 2
MIRT566786 MKL2 MKL1/myocardin like 2 2 2
MIRT567508 FOXC1 forkhead box C1 2 2
MIRT570235 CPNE5 copine 5 2 2
MIRT576823 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT610704 GPX6 glutathione peroxidase 6 2 2
MIRT611141 CRISP1 cysteine rich secretory protein 1 2 4
MIRT618100 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT619086 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT619716 FCF1 FCF1, rRNA-processing protein 2 2
MIRT620953 POLR2D RNA polymerase II subunit D 2 2
MIRT624645 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624655 ARMC10 armadillo repeat containing 10 2 2
MIRT630778 KLHL42 kelch like family member 42 2 4
MIRT635596 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT637122 MKX mohawk homeobox 2 2
MIRT645527 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647249 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT651508 WNT9A Wnt family member 9A 2 2
MIRT658721 ELK4 ELK4, ETS transcription factor 2 2
MIRT658804 EFNA5 ephrin A5 2 2
MIRT659319 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT664605 UGT3A1 UDP glycosyltransferase family 3 member A1 2 2
MIRT666047 STON2 stonin 2 2 2
MIRT672228 PDE7B phosphodiesterase 7B 2 2
MIRT683243 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT686565 TPM3 tropomyosin 3 2 2
MIRT697560 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT699294 SLC5A3 solute carrier family 5 member 3 2 2
MIRT707134 TRA2B transformer 2 beta homolog 2 2
MIRT712255 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT713896 IGF2R insulin like growth factor 2 receptor 2 2
MIRT716186 UBN2 ubinuclein 2 2 2
MIRT716525 KSR2 kinase suppressor of ras 2 2 2
MIRT716968 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT717154 LRRC3C leucine rich repeat containing 3C 2 2
MIRT718669 LSM10 LSM10, U7 small nuclear RNA associated 2 2
MIRT722100 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT723569 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT724703 CRAMP1L cramped chromatin regulator homolog 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6715b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6715b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission