pre-miRNA Information
pre-miRNA hsa-mir-3135b   
Genomic Coordinates chr6: 32749912 - 32749979
Description Homo sapiens miR-3135b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3135b
Sequence 7| GGCUGGAGCGAGUGCAGUGGUG |28
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1437307191 2 dbSNP
rs1202765326 3 dbSNP
rs905889141 5 dbSNP
rs922757991 8 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PRMT3   
Synonyms HRMT1L3
Description protein arginine methyltransferase 3
Transcript NM_001145166   
Other Transcripts NM_001145167 , NM_005788   
Expression
Putative miRNA Targets on PRMT3
3'UTR of PRMT3
(miRNA target sites are highlighted)
>PRMT3|NM_001145166|3'UTR
   1 AACAGCCATAAAAGCACACTACCTTGTAGTTTTTAATGTGGGGGTAGAGTGGGTCAGCAGGAGGGAGCTGGTTTTATGTG
  81 AGCAGATGGATGGATGATGGACCCTTTCCTAATGAGCCTCCTCAATAAGAGAGAAGTTCTCATTGTGGGAATCTGACATA
 161 GTTCAGCTGAGGAAGAGAATCAGCTGATCCTCATGGTCTGCCACGTAATCATTTTCTTAGACGTTTGCTCCACCAGATTT
 241 AACCAAATGTAACTCCCACATTGAGTTTATCTATATTGAAAATCATTTACATTGGCCTATATTTGGAAGAGAGATAGTCT
 321 TTTGTTTTTAATAAGTTTCTTACTATAAATTTTAAACAAATTGGTTAGTTATTTGGATATTTTATTAAACTAGTAACACA
 401 GGTACTACACATTTTATTATGGACTCCTCTGAGGAGGAGTTTTTAATTGTATTTGCTAGAAAATCAGGATGTAATAAAGA
 481 TTTGTATAAAAAAACTAAAATATGGAAAAGAGCTTCAGCCTTCATATACAAATCATATATGCAGACAGCCTAGTTGATTA
 561 TCTAGCATACTTAGGGTTCTCATTTTGTAGTTTCTTCCCTCTTTGTGACTATTCCTTAGCCTTATAGATTTCTAGTACTG
 641 CCCAGGAAATCTAATTTCAATACATTTATCCTAGGTTTCATGAAAGTTTTTAAAGATTGGGATAAATATGTACTTATTTA
 721 CTAACGTATTATCTTTTTCAAACCAGATTTATGTGCAAAGGTTAAACATGTAACTGTTACTAAGCAGTCTATAAAGTTGT
 801 CATTTACAATTACTGATTCAATTTGAAATGTAGAATAAAATTTTAATAAAATGTATCCTTATAAAATATTTTAAAAATAT
 881 TGATATTATAAAAGTTTTCAATAAAATATATCAAACAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' guggugacgugagCGAGGUCGg 5'
                       |||:|||| 
Target 5' aatatggaaaagaGCTTCAGCc 3'
499 - 520 129.00 -15.30
2
miRNA  3' guggugacGUGAGCGAGGUCGg 5'
                  |::|:|||||| | 
Target 5' ttcttagaCGTTTGCTCCACCa 3'
214 - 235 126.00 -19.80
3
miRNA  3' guggugacgugagcgAGGUCGg 5'
                         |:|||| 
Target 5' gggaatctgacatagTTCAGCt 3'
147 - 168 104.00 -9.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28859158 2 COSMIC
COSN31561139 14 COSMIC
COSN26435666 22 COSMIC
COSN30180161 45 COSMIC
COSN30447162 45 COSMIC
COSN30453217 90 COSMIC
COSN5259063 97 COSMIC
COSN30470201 109 COSMIC
COSN30470154 110 COSMIC
COSN30172541 130 COSMIC
COSN24381382 133 COSMIC
COSN20092323 143 COSMIC
COSN17183264 220 COSMIC
COSN20108046 512 COSMIC
COSN5825163 756 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373516049 3 dbSNP
rs763009791 3 dbSNP
rs1199078816 4 dbSNP
rs1421824670 6 dbSNP
rs767529840 9 dbSNP
rs775495797 10 dbSNP
rs752729995 11 dbSNP
rs747944035 15 dbSNP
rs1448909174 20 dbSNP
rs1189216324 21 dbSNP
rs370972379 24 dbSNP
rs763916954 25 dbSNP
rs753589736 27 dbSNP
rs1402513765 30 dbSNP
rs1470726351 31 dbSNP
rs58477713 35 dbSNP
rs899895951 35 dbSNP
rs756922176 39 dbSNP
rs1211003130 40 dbSNP
rs528083235 40 dbSNP
rs375527046 41 dbSNP
rs757956120 42 dbSNP
rs551691220 43 dbSNP
rs367604428 44 dbSNP
rs200448599 45 dbSNP
rs1231533608 47 dbSNP
rs1314083964 50 dbSNP
rs773314203 51 dbSNP
rs537219681 54 dbSNP
rs1362583373 57 dbSNP
rs995354450 62 dbSNP
rs1048672240 66 dbSNP
rs1450215643 69 dbSNP
rs1321727725 70 dbSNP
rs1404875696 72 dbSNP
rs1346004899 77 dbSNP
rs774058203 84 dbSNP
rs781559194 85 dbSNP
rs1464548775 87 dbSNP
rs1209377929 90 dbSNP
rs1467129180 94 dbSNP
rs748516283 96 dbSNP
rs770048187 98 dbSNP
rs1197927321 99 dbSNP
rs1378045100 101 dbSNP
rs1420876166 102 dbSNP
rs1481279658 105 dbSNP
rs1156594127 111 dbSNP
rs557224594 114 dbSNP
rs1457324959 117 dbSNP
rs1290049609 118 dbSNP
rs1387816154 120 dbSNP
rs763066003 122 dbSNP
rs1323439799 124 dbSNP
rs771084706 126 dbSNP
rs1225718248 128 dbSNP
rs1286696000 131 dbSNP
rs11540509 132 dbSNP
rs746881535 132 dbSNP
rs774602023 135 dbSNP
rs567362164 136 dbSNP
rs573046484 143 dbSNP
rs753663385 144 dbSNP
rs761553984 146 dbSNP
rs1490796878 149 dbSNP
rs748435776 152 dbSNP
rs771815670 153 dbSNP
rs553197327 154 dbSNP
rs1243459522 156 dbSNP
rs1384103981 158 dbSNP
rs764925529 159 dbSNP
rs767078456 161 dbSNP
rs914736715 161 dbSNP
rs573152586 162 dbSNP
rs545042855 165 dbSNP
rs980369767 166 dbSNP
rs928864827 167 dbSNP
rs957750041 168 dbSNP
rs1163247367 169 dbSNP
rs1366668882 170 dbSNP
rs1407148619 173 dbSNP
rs1306513967 174 dbSNP
rs779474588 175 dbSNP
rs938371050 176 dbSNP
rs990279952 184 dbSNP
rs1188688863 187 dbSNP
rs751080998 191 dbSNP
rs1248718116 192 dbSNP
rs1176671530 193 dbSNP
rs1481024113 194 dbSNP
rs1309387255 195 dbSNP
rs1320070086 197 dbSNP
rs914764869 199 dbSNP
rs918345205 200 dbSNP
rs1265976767 202 dbSNP
rs538038582 205 dbSNP
rs558822924 206 dbSNP
rs1321161288 216 dbSNP
rs978106778 217 dbSNP
rs1048744831 219 dbSNP
rs7119577 221 dbSNP
rs557033034 223 dbSNP
rs1040995857 224 dbSNP
rs901066586 234 dbSNP
rs768112245 237 dbSNP
rs146842980 240 dbSNP
rs879158786 245 dbSNP
rs1362247397 255 dbSNP
rs1181444285 259 dbSNP
rs944039607 260 dbSNP
rs1399264434 262 dbSNP
rs149067015 266 dbSNP
rs1197400293 268 dbSNP
rs1031641668 274 dbSNP
rs1269580898 279 dbSNP
rs1229537044 283 dbSNP
rs1211380555 300 dbSNP
rs530234061 302 dbSNP
rs143078934 304 dbSNP
rs1259766397 307 dbSNP
rs1239241541 311 dbSNP
rs556136244 312 dbSNP
rs762987726 316 dbSNP
rs1329055835 319 dbSNP
rs1022241623 320 dbSNP
rs149965363 320 dbSNP
rs970266410 327 dbSNP
rs542666488 332 dbSNP
rs1324831636 348 dbSNP
rs1388885306 352 dbSNP
rs1461962661 353 dbSNP
rs776144062 359 dbSNP
rs886968508 360 dbSNP
rs200153164 364 dbSNP
rs1414493639 365 dbSNP
rs1209925209 367 dbSNP
rs928894048 373 dbSNP
rs1004030036 377 dbSNP
rs559222106 385 dbSNP
rs528084403 391 dbSNP
rs1046761208 393 dbSNP
rs1473918066 396 dbSNP
rs551422609 396 dbSNP
rs1180077702 399 dbSNP
rs1445221409 414 dbSNP
rs562457513 431 dbSNP
rs1472976410 435 dbSNP
rs761365035 437 dbSNP
rs1159725213 438 dbSNP
rs1390766304 439 dbSNP
rs1465938821 447 dbSNP
rs906430278 449 dbSNP
rs1001832488 452 dbSNP
rs1323708045 454 dbSNP
rs1048129754 470 dbSNP
rs1333343498 473 dbSNP
rs1325205744 477 dbSNP
rs1359348374 484 dbSNP
rs1327763152 488 dbSNP
rs1391066775 488 dbSNP
rs910933338 488 dbSNP
rs1335049137 489 dbSNP
rs1469340454 496 dbSNP
rs1305825368 497 dbSNP
rs1425886410 498 dbSNP
rs575221791 499 dbSNP
rs1174392736 503 dbSNP
rs942566696 521 dbSNP
rs1033268152 527 dbSNP
rs1474361181 535 dbSNP
rs536246984 539 dbSNP
rs1188946164 547 dbSNP
rs183368804 548 dbSNP
rs373171875 550 dbSNP
rs1202704543 568 dbSNP
rs1442655472 591 dbSNP
rs935226634 594 dbSNP
rs1053147017 598 dbSNP
rs1337989416 599 dbSNP
rs773356153 602 dbSNP
rs1297563124 605 dbSNP
rs891775288 609 dbSNP
rs1367864189 610 dbSNP
rs1329436956 615 dbSNP
rs1452103111 617 dbSNP
rs879018821 625 dbSNP
rs115707050 626 dbSNP
rs1279841205 629 dbSNP
rs967975036 650 dbSNP
rs977595813 654 dbSNP
rs567410000 656 dbSNP
rs912821289 659 dbSNP
rs965588315 663 dbSNP
rs1383091989 672 dbSNP
rs1182759702 684 dbSNP
rs186549366 693 dbSNP
rs1035813774 694 dbSNP
rs960319901 697 dbSNP
rs1436788089 701 dbSNP
rs1251364655 705 dbSNP
rs1483391244 718 dbSNP
rs921296815 727 dbSNP
rs1025760383 737 dbSNP
rs931287288 742 dbSNP
rs1289991825 745 dbSNP
rs553425216 746 dbSNP
rs1380136884 754 dbSNP
rs1286219731 755 dbSNP
rs1440112441 759 dbSNP
rs566901118 771 dbSNP
rs939861227 777 dbSNP
rs191424913 786 dbSNP
rs906462868 789 dbSNP
rs937969793 803 dbSNP
rs1415502910 810 dbSNP
rs1435796538 820 dbSNP
rs1469317731 823 dbSNP
rs910975227 832 dbSNP
rs1183752882 834 dbSNP
rs1484293093 841 dbSNP
rs1267443052 842 dbSNP
rs942392694 847 dbSNP
rs1054958722 849 dbSNP
rs1322772586 856 dbSNP
rs1292281934 857 dbSNP
rs35736700 858 dbSNP
rs754319265 858 dbSNP
rs1328761731 860 dbSNP
rs1289024488 861 dbSNP
rs1409897122 866 dbSNP
rs893502926 871 dbSNP
rs868580770 876 dbSNP
rs1292936009 882 dbSNP
rs1021142941 883 dbSNP
rs1052367140 893 dbSNP
rs572492773 912 dbSNP
rs538627650 916 dbSNP
rs1412280201 925 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0018985
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' guGGUGACGUGAGCGAGGUCGg 5'
            ||||||||    ||||||| 
Target 5' ugCCACUGCA----CUCCAGCc 3'
10 - 27
Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000331079.6 | 3UTR | UCAAGAUCGUGCCACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
305 hsa-miR-3135b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT079084 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT118055 SLC1A5 solute carrier family 1 member 5 2 2
MIRT195529 SNTB2 syntrophin beta 2 2 2
MIRT312491 SLC26A2 solute carrier family 26 member 2 2 2
MIRT366306 GDI1 GDP dissociation inhibitor 1 2 4
MIRT448908 CLCN6 chloride voltage-gated channel 6 2 4
MIRT451874 SOD2 superoxide dismutase 2 2 8
MIRT454235 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454512 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT457728 SMOX spermine oxidase 2 2
MIRT459797 POTED POTE ankyrin domain family member D 2 10
MIRT459905 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT462667 HMOX1 heme oxygenase 1 2 2
MIRT466798 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT468954 RPS14 ribosomal protein S14 2 2
MIRT469458 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470214 PRRC2B proline rich coiled-coil 2B 2 2
MIRT470503 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT476142 GPR137C G protein-coupled receptor 137C 2 8
MIRT476864 FHL2 four and a half LIM domains 2 2 4
MIRT478052 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 10
MIRT480647 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT488513 CD3E CD3e molecule 2 2
MIRT497664 PRMT3 protein arginine methyltransferase 3 2 2
MIRT498656 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT499315 ZNF485 zinc finger protein 485 2 10
MIRT499761 CIRH1A UTP4, small subunit processome component 2 8
MIRT501131 SLC2A1 solute carrier family 2 member 1 2 2
MIRT502292 GNG12 G protein subunit gamma 12 2 6
MIRT503452 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT507072 H2AFX H2A histone family member X 2 4
MIRT509947 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT514508 SHISA9 shisa family member 9 2 4
MIRT515507 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT515912 MFAP2 microfibril associated protein 2 2 2
MIRT516412 COPA coatomer protein complex subunit alpha 2 2
MIRT516477 RAB32 RAB32, member RAS oncogene family 2 2
MIRT517863 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT518785 MED16 mediator complex subunit 16 2 4
MIRT518952 GRK7 G protein-coupled receptor kinase 7 2 2
MIRT519227 PYCARD PYD and CARD domain containing 2 2
MIRT522561 MCAM melanoma cell adhesion molecule 2 4
MIRT523767 FBXO27 F-box protein 27 2 4
MIRT528364 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT529369 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529978 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT530454 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT531643 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531751 TXK TXK tyrosine kinase 2 2
MIRT531915 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532024 FHDC1 FH2 domain containing 1 2 2
MIRT533117 YIPF4 Yip1 domain family member 4 2 4
MIRT534713 RFX7 regulatory factor X7 2 2
MIRT535473 PARVB parvin beta 2 6
MIRT535769 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536744 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537943 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT539525 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540255 FAM89A family with sequence similarity 89 member A 2 2
MIRT540440 RBM43 RNA binding motif protein 43 2 2
MIRT542984 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT543426 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT544676 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT544727 NDRG1 N-myc downstream regulated 1 2 2
MIRT545196 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT553254 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553277 TVP23B trans-golgi network vesicle protein 23 homolog B 2 2
MIRT565018 VIM vimentin 2 2
MIRT565931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT569796 CSF1 colony stimulating factor 1 2 2
MIRT570259 PRSS16 protease, serine 16 2 2
MIRT570785 ORC6 origin recognition complex subunit 6 2 2
MIRT571144 HM13 histocompatibility minor 13 2 2
MIRT572818 MYO1C myosin IC 2 2
MIRT575204 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT575284 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575304 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575325 Fbxo6 F-box protein 6 2 2
MIRT575381 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575675 Map1b microtubule-associated protein 1B 2 2
MIRT576902 Poteg POTE ankyrin domain family, member G 2 2
MIRT607049 IDS iduronate 2-sulfatase 2 2
MIRT607067 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607492 HEBP2 heme binding protein 2 2 2
MIRT607524 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607657 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607797 RHBDL2 rhomboid like 2 2 2
MIRT607844 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607931 ANG angiogenin 2 3
MIRT607968 SNX22 sorting nexin 22 2 2
MIRT608076 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608100 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT608143 SYAP1 synapse associated protein 1 2 2
MIRT608905 ZNF790 zinc finger protein 790 2 2
MIRT612930 GPRIN3 GPRIN family member 3 2 2
MIRT616768 LONP2 lon peptidase 2, peroxisomal 2 2
MIRT617446 CCS copper chaperone for superoxide dismutase 2 2
MIRT617554 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618774 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618928 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619248 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620572 WBSCR27 methyltransferase like 27 2 4
MIRT622655 POU2F3 POU class 2 homeobox 3 2 4
MIRT623175 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624167 DGKE diacylglycerol kinase epsilon 2 2
MIRT625270 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625398 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625696 OPTN optineurin 2 2
MIRT626095 MKLN1 muskelin 1 2 2
MIRT626433 CHDH choline dehydrogenase 2 2
MIRT627015 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627079 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627142 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627349 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627422 THAP2 THAP domain containing 2 2 2
MIRT627443 TAS2R5 taste 2 receptor member 5 2 2
MIRT627882 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT628080 KAT7 lysine acetyltransferase 7 2 4
MIRT628278 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629096 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629238 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629288 UNC13A unc-13 homolog A 2 2
MIRT629409 ADM2 adrenomedullin 2 2 2
MIRT629586 RFC2 replication factor C subunit 2 2 2
MIRT629637 WDR31 WD repeat domain 31 2 2
MIRT629876 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629986 NARS asparaginyl-tRNA synthetase 2 2
MIRT630045 TERF2 telomeric repeat binding factor 2 2 2
MIRT630063 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630129 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630157 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630254 SMTNL2 smoothelin like 2 2 2
MIRT630280 PSMB5 proteasome subunit beta 5 2 2
MIRT630349 NKAP NFKB activating protein 2 2
MIRT630499 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT630554 ROBO1 roundabout guidance receptor 1 2 4
MIRT631266 CENPM centromere protein M 2 2
MIRT631405 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632472 RPS15A ribosomal protein S15a 2 2
MIRT632513 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT632598 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632996 DUSP18 dual specificity phosphatase 18 2 2
MIRT633084 CXorf21 chromosome X open reading frame 21 2 2
MIRT633241 ZNF573 zinc finger protein 573 2 2
MIRT633538 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634340 SGOL1 shugoshin 1 2 2
MIRT634602 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635052 MYH11 myosin heavy chain 11 2 2
MIRT635106 MAVS mitochondrial antiviral signaling protein 2 2
MIRT635238 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635324 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636270 RNF157 ring finger protein 157 2 2
MIRT636452 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636518 FMN1 formin 1 2 2
MIRT636655 CDK4 cyclin dependent kinase 4 2 2
MIRT636757 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637136 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637190 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637290 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637535 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637695 CEP89 centrosomal protein 89 2 2
MIRT637790 OLA1 Obg like ATPase 1 2 2
MIRT637927 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638451 PLXDC2 plexin domain containing 2 2 2
MIRT640674 ARSK arylsulfatase family member K 2 2
MIRT642645 PTGR2 prostaglandin reductase 2 2 2
MIRT643084 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT644238 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644667 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645094 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645995 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646510 FAM217B family with sequence similarity 217 member B 2 2
MIRT647015 ADCY2 adenylate cyclase 2 3 2
MIRT647097 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647716 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648042 FADS6 fatty acid desaturase 6 2 2
MIRT648512 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648867 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649184 DNPEP aspartyl aminopeptidase 2 2
MIRT649662 TEP1 telomerase associated protein 1 2 2
MIRT651425 YME1L1 YME1 like 1 ATPase 2 2
MIRT651467 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652400 TMEM40 transmembrane protein 40 2 2
MIRT652598 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT653225 SOX17 SRY-box 17 2 2
MIRT653693 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654124 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT656472 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658907 DPY19L4 dpy-19 like 4 2 2
MIRT661103 SPIB Spi-B transcription factor 2 2
MIRT661240 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661293 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662237 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662546 MTAP methylthioadenosine phosphorylase 2 2
MIRT662622 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT662738 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662846 OMD osteomodulin 2 2
MIRT662909 MED18 mediator complex subunit 18 2 2
MIRT662958 JPH2 junctophilin 2 2 2
MIRT663342 ZNF74 zinc finger protein 74 2 2
MIRT663498 IYD iodotyrosine deiodinase 2 2
MIRT663525 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663544 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663905 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663974 ZNF786 zinc finger protein 786 2 2
MIRT664352 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664419 TIGD6 tigger transposable element derived 6 2 2
MIRT664470 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664959 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664973 TDRD1 tudor domain containing 1 2 2
MIRT665023 ELK1 ELK1, ETS transcription factor 2 2
MIRT665201 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665361 XKR4 XK related 4 2 2
MIRT665456 WDR17 WD repeat domain 17 2 2
MIRT666080 SSTR2 somatostatin receptor 2 2 2
MIRT666319 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666488 SBNO1 strawberry notch homolog 1 2 2
MIRT666520 RNF170 ring finger protein 170 2 2
MIRT666698 RBM23 RNA binding motif protein 23 2 2
MIRT666764 RAB10 RAB10, member RAS oncogene family 2 2
MIRT667228 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667361 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667476 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667560 LRAT lecithin retinol acyltransferase 2 2
MIRT667750 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668090 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668121 GK5 glycerol kinase 5 (putative) 2 2
MIRT668168 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668348 STXBP2 syntaxin binding protein 2 2 2
MIRT668511 ESYT2 extended synaptotagmin 2 2 2
MIRT669293 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669549 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669780 CNDP1 carnosine dipeptidase 1 2 2
MIRT669860 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670019 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670179 CCDC142 coiled-coil domain containing 142 2 2
MIRT671109 ZNF841 zinc finger protein 841 2 2
MIRT671353 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671478 FLYWCH2 FLYWCH family member 2 2 2
MIRT671494 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671555 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671670 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT671927 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672198 F2 coagulation factor II, thrombin 2 2
MIRT672219 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672254 SIK2 salt inducible kinase 2 2 2
MIRT672292 GP2 glycoprotein 2 2 2
MIRT672432 POLR2D RNA polymerase II subunit D 2 2
MIRT672599 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672903 KRBA2 KRAB-A domain containing 2 2 2
MIRT672960 ZNF655 zinc finger protein 655 2 2
MIRT673098 SYNPO2L synaptopodin 2 like 2 2
MIRT673174 TMEM56 transmembrane protein 56 2 2
MIRT673253 INO80 INO80 complex subunit 2 2
MIRT673298 RNF19B ring finger protein 19B 2 2
MIRT673577 KDELC2 KDEL motif containing 2 2 2
MIRT673739 TCF23 transcription factor 23 2 2
MIRT674029 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674284 NAGK N-acetylglucosamine kinase 2 2
MIRT674340 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674395 MYCBP MYC binding protein 2 2
MIRT674521 PRR23A proline rich 23A 2 2
MIRT675146 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT676027 C9orf69 transmembrane protein 250 2 2
MIRT676432 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676598 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678757 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680346 ZNF281 zinc finger protein 281 2 2
MIRT680469 C3 complement C3 2 2
MIRT682828 FLG2 filaggrin family member 2 2 2
MIRT682883 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684406 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685277 KIAA1143 KIAA1143 2 2
MIRT686063 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693892 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699344 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699911 RUNDC1 RUN domain containing 1 2 2
MIRT700809 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701809 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702176 LYRM4 LYR motif containing 4 2 2
MIRT702297 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT704064 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT706209 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706631 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706662 RNF216 ring finger protein 216 2 2
MIRT706684 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706707 GPR155 G protein-coupled receptor 155 2 2
MIRT706779 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706846 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706865 MAFF MAF bZIP transcription factor F 2 2
MIRT706898 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706919 THAP6 THAP domain containing 6 2 2
MIRT706964 FANCC Fanconi anemia complementation group C 2 2
MIRT706982 XPO5 exportin 5 2 2
MIRT707017 RRP36 ribosomal RNA processing 36 2 2
MIRT707034 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707074 MED29 mediator complex subunit 29 2 2
MIRT709370 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT709584 ITPA inosine triphosphatase 2 2
MIRT709692 CUBN cubilin 2 2
MIRT711485 GDF7 growth differentiation factor 7 2 2
MIRT713577 SLC2A8 solute carrier family 2 member 8 2 2
MIRT722798 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT724200 MED7 mediator complex subunit 7 2 2
MIRT736146 GRB2 growth factor receptor bound protein 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-Fluorouracil approved 3385 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-31 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-31 Doxorubicin approved 31703 Microarray heart 22859947 2012 up-regulated
miR-31 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 down-regulated
miR-31 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-31 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 up-regulated
miR-31 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-31 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-31 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-31 Valproate approved 3121 Quantitative real-time PCR CD4+, CD25- T cells 20427269 2010 down-regulated
miR-31 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-31 Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-mir-31 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-mir-31 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-31 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-31 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-31 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-31 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-3135b Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-3135b Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-mir-3135b Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-3135b Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-3135b Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-3135b Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-3135b Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3135b Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-3135b Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission