miRTarBase - #MIRT497753


—
pre-miRNA Information
pre-miRNA hsa-mir-216b   
Genomic Coordinates chr2: 56000714 - 56000795
Description Homo sapiens miR-216b stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-216b-5p
Sequence 11| AAAUCUCUGCAGGCAAAUGUGA |32
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs746268253 9 dbSNP
rs777165632 10 dbSNP
rs528642031 11 dbSNP
rs1168114631 14 dbSNP
rs559876972 16 dbSNP
rs1415888803 17 dbSNP
rs756876970 18 dbSNP
rs930279879 18 dbSNP
rs777776673 19 dbSNP
rs1182789155 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B5PHM2 miR-216b Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma MiRNA qPCR analyses
Gene Information
Gene Symbol OXGR1   
Synonyms GPR80, GPR99, P2RY15, P2Y15, aKGR
Description oxoglutarate receptor 1
Transcript NM_080818   
Expression
Putative miRNA Targets on OXGR1
3'UTR of OXGR1
(miRNA target sites are highlighted)		 
>OXGR1|NM_080818|3'UTR
   1 AATATTTCATTTACTTAACCAAAAACAAATACTTGCTGATACTTTACCTAGCATCCTAAGATGTTCAGGATGTCTCCCTC
  81 AATGGAACTCCTGGTAAATACTGTGTATTCAAGTAATCATGTGCCAAAGCCAGGGCAGAGCTTCTAGTTCTTTGCAATCC
 161 CTTTATTGAGCTCCTCCACTGGGGAGATATAAGAATGGGATGCATGTATATCAGCAAAGTATTCAGACATAGTATTACAA
 241 GCTATTGGAACTCAGAGGCATCTTAGAGAACATCTGTTCCCACCAACTTACTATATATACACGGAAACCAATTTCTTACC
 321 CTTGCCCTAGATTGCTCAGTAAATTTGTGCCAAGATAGGAGAAAACCAATCTTTTCACTCATCATTTCATGCTTCTCTGC
 401 ACTCTGGGCCTATTTGTATTGAACCATTAGACAATTCAAACCACTACTTGTATCTTTCTTAATATTTATTTTTTACATCT
 481 CAGAGCTCTACAATTTGTTTCCTTCAAGCTTAACTTTGAGATTATAAAACTGGGTTTAGCCAGTTCTGTATATTACTTCA
 561 AGCCAGTAAGATACCCTTGAAATAATCCAAGGACGTCCATGCAAATAGTTGAAATTAGTACCTGCAATATATTTGGAGTA
 641 TTATGTCTTTATTGTTGTTAAAAAGTTTTTATTGAATGTATGAAAATTATCAAATTGTATTCATCATTATTAACATGTCC
 721 TGGGGAAGGAAGGGAAACTTTCTAGGACAGAAGTCACTTTCAGATGTCATGTATGTATTGGGTGTTCAATCATATCTAAC
 801 ACTGTTTTGATTTTTGTGGGAAAATATTCCAGGAAACGCTAATTCTCTTTAGACTCCTTGTTCTTTTATGACTACAATGA
 881 ACATATGTCTATGTGATAGCTAAAGATATTTTTGAATTGTATGTGTGCTTAATTATCGGTAAGTATAAATATTTGAGAAA
 961 ACACATGGTCTGGATATTTAAAACCCTCATAAACATGTTGGTACAGTTAATAAACTTATTTATAATT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aguGUAAACGG--------ACGUCUCUAAa 5'
             ||| ||||         |||||| || 
Target 5' aatCATGTGCCAAAGCCAGGGCAGAGCTTc 3'
 115 - 144 125.00 -12.46
2 
miRNA  3' agUGUAAACGGA--------CG---UCUCUAAa 5'
            |||| ||:||        ||   ||| ||| 
Target 5' gaACATATGTCTATGTGATAGCTAAAGATATTt 3'
 879 - 911 122.00 -6.80
3 
miRNA  3' aguguaaacggacguCUCUAAa 5'
                         |||||| 
Target 5' ttcaagcttaactttGAGATTa 3'
 503 - 524 120.00 -5.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30525069 20 COSMIC
COSN31555116 37 COSMIC
COSN28134222 56 COSMIC
COSN30535593 65 COSMIC
COSN31507285 75 COSMIC
COSN30100743 77 COSMIC
COSN30178536 93 COSMIC
COSN25102971 100 COSMIC
COSN30450935 134 COSMIC
COSN23783576 142 COSMIC
COSN31609895 193 COSMIC
COSN6634874 733 COSMIC
COSN1637140 1011 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs868500803 8 dbSNP
rs761313522 10 dbSNP
rs771860912 11 dbSNP
rs773825275 12 dbSNP
rs759255130 13 dbSNP
rs768349854 14 dbSNP
rs1221354432 16 dbSNP
rs1371454455 25 dbSNP
rs1307584029 26 dbSNP
rs1410685850 27 dbSNP
rs748796798 29 dbSNP
rs779759921 31 dbSNP
rs1187809552 32 dbSNP
rs1367244739 33 dbSNP
rs769289307 35 dbSNP
rs145452744 38 dbSNP
rs1016626383 39 dbSNP
rs1418348563 41 dbSNP
rs189186212 42 dbSNP
rs1487208223 43 dbSNP
rs757011632 46 dbSNP
rs560920258 47 dbSNP
rs544323460 48 dbSNP
rs570756439 54 dbSNP
rs575341391 59 dbSNP
rs1242608682 60 dbSNP
rs1269417622 61 dbSNP
rs1033860276 62 dbSNP
rs1004163301 69 dbSNP
rs1317546742 70 dbSNP
rs564711935 72 dbSNP
rs1342876756 82 dbSNP
rs1041250949 84 dbSNP
rs1254672749 87 dbSNP
rs1007456391 90 dbSNP
rs1241838526 98 dbSNP
rs117409629 99 dbSNP
rs945344600 103 dbSNP
rs1170019539 106 dbSNP
rs573026807 117 dbSNP
rs1053844698 118 dbSNP
rs1433547445 122 dbSNP
rs1043552705 129 dbSNP
rs947439639 130 dbSNP
rs913236927 139 dbSNP
rs943449051 150 dbSNP
rs1317588312 152 dbSNP
rs1362720175 153 dbSNP
rs1053045451 160 dbSNP
rs911026917 164 dbSNP
rs935282973 166 dbSNP
rs552865865 171 dbSNP
rs1371059943 175 dbSNP
rs1232621855 177 dbSNP
rs985315495 180 dbSNP
rs1285175037 185 dbSNP
rs184285545 189 dbSNP
rs751914089 203 dbSNP
rs1405319511 205 dbSNP
rs756091534 208 dbSNP
rs1201485441 209 dbSNP
rs1300836536 212 dbSNP
rs933859407 219 dbSNP
rs1190970307 241 dbSNP
rs1248254403 246 dbSNP
rs1453460695 250 dbSNP
rs927855692 254 dbSNP
rs922537767 259 dbSNP
rs1378815218 260 dbSNP
rs1466134847 270 dbSNP
rs973090369 276 dbSNP
rs981988606 287 dbSNP
rs1458607856 288 dbSNP
rs1016567621 292 dbSNP
rs1389619366 293 dbSNP
rs1386474565 302 dbSNP
rs1299500155 307 dbSNP
rs554176377 323 dbSNP
rs1234068553 334 dbSNP
rs1288252507 337 dbSNP
rs1327780008 349 dbSNP
rs1157694744 351 dbSNP
rs192738081 355 dbSNP
rs983880697 365 dbSNP
rs17301222 374 dbSNP
rs1207659397 376 dbSNP
rs1025356440 382 dbSNP
rs972386164 384 dbSNP
rs965686739 389 dbSNP
rs879207911 390 dbSNP
rs1020267741 391 dbSNP
rs1033885185 392 dbSNP
rs537131322 396 dbSNP
rs889958712 404 dbSNP
rs1409661928 408 dbSNP
rs906722226 414 dbSNP
rs1159603686 424 dbSNP
rs1021707605 431 dbSNP
rs1393402103 441 dbSNP
rs1456201411 442 dbSNP
rs1021185951 444 dbSNP
rs571738116 447 dbSNP
rs1011656909 448 dbSNP
rs891873488 450 dbSNP
rs1207083000 458 dbSNP
rs1053076139 463 dbSNP
rs1009839689 465 dbSNP
rs893785606 467 dbSNP
rs767206946 470 dbSNP
rs1260414683 475 dbSNP
rs907176114 476 dbSNP
rs1243088137 479 dbSNP
rs551455919 487 dbSNP
rs1488643802 492 dbSNP
rs889205227 496 dbSNP
rs759106033 507 dbSNP
rs1483765120 510 dbSNP
rs774198882 514 dbSNP
rs141110769 515 dbSNP
rs1421816221 521 dbSNP
rs564543279 523 dbSNP
rs931086515 528 dbSNP
rs1344584063 530 dbSNP
rs918328095 531 dbSNP
rs188156899 534 dbSNP
rs1168220893 538 dbSNP
rs965437404 539 dbSNP
rs1019250000 544 dbSNP
rs986118246 546 dbSNP
rs1309108516 547 dbSNP
rs1379154397 550 dbSNP
rs529664015 563 dbSNP
rs138296283 565 dbSNP
rs1383746163 569 dbSNP
rs1362210126 570 dbSNP
rs939948347 573 dbSNP
rs954316439 574 dbSNP
rs1321927326 575 dbSNP
rs1227153648 576 dbSNP
rs1021782553 587 dbSNP
rs1343602985 588 dbSNP
rs1011686691 589 dbSNP
rs146502547 592 dbSNP
rs61368531 594 dbSNP
rs1002930030 595 dbSNP
rs61975469 597 dbSNP
rs1044366053 598 dbSNP
rs1256531899 613 dbSNP
rs948006068 615 dbSNP
rs1195755691 622 dbSNP
rs1448675739 624 dbSNP
rs895056975 636 dbSNP
rs1388566877 638 dbSNP
rs1431692798 642 dbSNP
rs1048288384 643 dbSNP
rs1197654737 644 dbSNP
rs1169381228 646 dbSNP
rs931116039 650 dbSNP
rs1429538098 652 dbSNP
rs970895202 654 dbSNP
rs918400157 657 dbSNP
rs972491906 669 dbSNP
rs1434839018 670 dbSNP
rs1294923100 676 dbSNP
rs1261287331 677 dbSNP
rs1184999393 680 dbSNP
rs1009791500 694 dbSNP
rs958281369 698 dbSNP
rs943769245 703 dbSNP
rs1212098974 704 dbSNP
rs1256520433 706 dbSNP
rs1464227089 710 dbSNP
rs1186505647 714 dbSNP
rs1246419531 715 dbSNP
rs912252987 716 dbSNP
rs985135152 723 dbSNP
rs1451607941 738 dbSNP
rs777063389 742 dbSNP
rs914805205 744 dbSNP
rs368565222 746 dbSNP
rs1424493621 749 dbSNP
rs990335993 766 dbSNP
rs1032635995 771 dbSNP
rs956218910 774 dbSNP
rs1178793239 779 dbSNP
rs374560961 783 dbSNP
rs1457038280 785 dbSNP
rs889145692 791 dbSNP
rs565013867 794 dbSNP
rs544645753 795 dbSNP
rs1319007791 797 dbSNP
rs1051839890 801 dbSNP
rs1435300740 802 dbSNP
rs1273910827 806 dbSNP
rs900969555 809 dbSNP
rs998026876 809 dbSNP
rs1301878902 810 dbSNP
rs1204176904 811 dbSNP
rs1206556464 812 dbSNP
rs1269844661 836 dbSNP
rs370563470 837 dbSNP
rs1216724820 838 dbSNP
rs1254226644 843 dbSNP
rs558969136 854 dbSNP
rs909794357 857 dbSNP
rs1307866682 858 dbSNP
rs971505066 860 dbSNP
rs1048326308 861 dbSNP
rs1023423671 868 dbSNP
rs937671578 883 dbSNP
rs1012909217 890 dbSNP
rs1294337795 891 dbSNP
rs1380192356 892 dbSNP
rs747617943 893 dbSNP
rs144105178 894 dbSNP
rs1451345076 904 dbSNP
rs775962322 905 dbSNP
rs1401655328 919 dbSNP
rs1322399954 921 dbSNP
rs995395300 927 dbSNP
rs573632264 932 dbSNP
rs556713042 937 dbSNP
rs139275313 944 dbSNP
rs559156362 946 dbSNP
rs988307251 956 dbSNP
rs943817614 964 dbSNP
rs58399642 965 dbSNP
rs1032583446 966 dbSNP
rs1289418858 966 dbSNP
rs1450124586 968 dbSNP
rs1223831308 970 dbSNP
rs1049884922 973 dbSNP
rs1446706318 977 dbSNP
rs1007839063 980 dbSNP
rs1269635507 984 dbSNP
rs953381592 986 dbSNP
rs552279046 997 dbSNP
rs768662262 998 dbSNP
rs757524196 1000 dbSNP
rs1163108796 1001 dbSNP
rs1411143987 1015 dbSNP
rs749412862 1019 dbSNP
rs1163856568 1030 dbSNP
rs1036438236 1031 dbSNP
rs1253914001 1032 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions LCL35
Disease MIMAT0004959
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1020022. RNA binding protein: AGO2. Condition:EBV B95-8-infected ...

- Skalsky RL; Corcoran DL; Gottwein E; Frank et al., 2012, PLoS pathogens.

Article - Skalsky RL; Corcoran DL; Gottwein E; Frank et al.
- PLoS pathogens, 2012
Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.
LinkOut: [PMID: 22291592]
CLIP-seq Support 1 for dataset GSM1020022
Method / RBP PAR-CLIP / AGO2
Cell line / Condition LCL35 / EBV B95-8-infected, 4-thiouridine, RNase T1
Location of target site ENST00000298440.1 | 3UTR | UCAAGCUUAACUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22291592 / GSE41437
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD 0.997 0.02 1.000 0.5 3 Click to see details
CHOL 0.707 0.06 0.714 0.06 6 Click to see details
KICH -0.653 0.12 -0.700 0.09 5 Click to see details
KIRP -0.721 0.14 -0.400 0.3 4 Click to see details
PRAD -0.339 0.17 -0.455 0.09 10 Click to see details
THCA -0.221 0.19 -0.022 0.47 18 Click to see details
BLCA -0.61 0.2 0.000 0.5 4 Click to see details
LIHC -0.128 0.2 -0.055 0.36 44 Click to see details
HNSC -0.289 0.26 -0.179 0.35 7 Click to see details
UCEC -0.649 0.28 -0.500 0.33 3 Click to see details
LUAD -0.493 0.34 -0.500 0.33 3 Click to see details
STAD 0.196 0.35 -0.029 0.48 6 Click to see details
LUSC 0.121 0.41 -0.029 0.48 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
KIRC -0.076 0.44 -0.086 0.44 6 Click to see details
129 hsa-miR-216b-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006144 KRAS KRAS proto-oncogene, GTPase 3 1
MIRT007207 CSNK2A1 casein kinase 2 alpha 1 3 1
MIRT064260 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT169957 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 6
MIRT362970 CDK6 cyclin dependent kinase 6 2 2
MIRT437983 BECN1 beclin 1 3 2
MIRT443073 ABLIM1 actin binding LIM protein 1 2 2
MIRT443747 ZFAND5 zinc finger AN1-type containing 5 2 6
MIRT445488 KLF12 Kruppel like factor 12 2 2
MIRT447818 ZCCHC11 zinc finger CCHC-type containing 11 2 2
MIRT448753 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT460391 GUF1 GUF1 homolog, GTPase 2 2
MIRT466481 TECPR2 tectonin beta-propeller repeat containing 2 2 7
MIRT472205 NGFRAP1 brain expressed X-linked 3 2 4
MIRT473269 MID1 midline 1 2 2
MIRT489831 P2RY2 purinergic receptor P2Y2 2 2
MIRT497753 OXGR1 oxoglutarate receptor 1 2 2
MIRT502881 CDK4 cyclin dependent kinase 4 2 8
MIRT505904 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT506657 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510190 MON1B MON1 homolog B, secretory trafficking associated 2 4
MIRT512406 CD84 CD84 molecule 2 2
MIRT520342 UBXN2A UBX domain protein 2A 2 2
MIRT523602 FZD5 frizzled class receptor 5 2 2
MIRT529598 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT534444 SDR16C5 short chain dehydrogenase/reductase family 16C member 5 2 2
MIRT534739 RBM47 RNA binding motif protein 47 2 2
MIRT537285 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT546979 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT549862 MCM4 minichromosome maintenance complex component 4 2 2
MIRT552535 ZIC5 Zic family member 5 2 2
MIRT555322 PPP2CB protein phosphatase 2 catalytic subunit beta 2 2
MIRT555661 PGM3 phosphoglucomutase 3 2 2
MIRT559128 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT567802 DEK DEK proto-oncogene 2 2
MIRT567866 DCAF12 DDB1 and CUL4 associated factor 12 2 2
MIRT574661 KLHL15 kelch like family member 15 2 2
MIRT575029 Tecpr2 tectonin beta-propeller repeat containing 2 2 5
MIRT607227 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT609385 FAM216B family with sequence similarity 216 member B 2 4
MIRT612266 PDZD4 PDZ domain containing 4 2 2
MIRT617434 ANP32E acidic nuclear phosphoprotein 32 family member E 2 4
MIRT619453 NUP214 nucleoporin 214 2 2
MIRT620242 CCDC65 coiled-coil domain containing 65 2 2
MIRT620463 CENPN centromere protein N 2 2
MIRT620909 MUT methylmalonyl-CoA mutase 2 2
MIRT621006 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT621568 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT622059 SSBP2 single stranded DNA binding protein 2 2 2
MIRT622132 SP4 Sp4 transcription factor 2 2
MIRT623365 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT624370 CDK12 cyclin dependent kinase 12 2 2
MIRT627944 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT628228 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT630150 ZDHHC9 zinc finger DHHC-type containing 9 2 2
MIRT630237 SORD sorbitol dehydrogenase 2 2
MIRT631271 CENPM centromere protein M 2 2
MIRT637456 ZNF324B zinc finger protein 324B 2 2
MIRT637899 SLC19A3 solute carrier family 19 member 3 2 2
MIRT641610 CAPN7 calpain 7 2 2
MIRT643088 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643813 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT643911 TCEB2 elongin B 2 2
MIRT644900 ZBED1 zinc finger BED-type containing 1 2 2
MIRT645012 NGRN neugrin, neurite outgrowth associated 2 2
MIRT645521 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT646032 S100A7A S100 calcium binding protein A7A 2 2
MIRT646626 CENPL centromere protein L 2 2
MIRT646721 RHOG ras homolog family member G 2 2
MIRT647196 ZNF583 zinc finger protein 583 2 2
MIRT648010 ZNF431 zinc finger protein 431 2 2
MIRT648362 AKIP1 A-kinase interacting protein 1 2 2
MIRT648400 WRN Werner syndrome RecQ like helicase 2 2
MIRT648833 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT651870 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT652490 TMEM178B transmembrane protein 178B 2 2
MIRT652529 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT652536 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT652795 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT653379 SMAD1 SMAD family member 1 2 2
MIRT655568 P2RX7 purinergic receptor P2X 7 2 2
MIRT657235 IER5 immediate early response 5 2 2
MIRT657594 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT658037 FZD9 frizzled class receptor 9 2 2
MIRT658151 FGF10 fibroblast growth factor 10 2 2
MIRT658459 FAM117B family with sequence similarity 117 member B 2 2
MIRT658503 EXOC5 exocyst complex component 5 2 2
MIRT659420 COL4A4 collagen type IV alpha 4 chain 2 2
MIRT660023 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT660032 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT661206 MPPE1 metallophosphoesterase 1 2 2
MIRT661639 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT665303 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT668010 HCFC2 host cell factor C2 2 2
MIRT673436 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT673583 KDELC2 KDEL motif containing 2 2 2
MIRT673717 SLU7 SLU7 homolog, splicing factor 2 2
MIRT674315 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT675811 MED28 mediator complex subunit 28 2 2
MIRT686564 TPM3 tropomyosin 3 2 2
MIRT687134 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687463 NKD1 naked cuticle homolog 1 2 2
MIRT690226 C5orf45 MRN complex interacting protein 2 2
MIRT690532 ZNF566 zinc finger protein 566 2 2
MIRT693077 AS3MT arsenite methyltransferase 2 2
MIRT694083 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT695388 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT695638 SLC26A2 solute carrier family 26 member 2 2 2
MIRT696540 C3 complement C3 2 2
MIRT705522 ARL6IP1 ADP ribosylation factor like GTPase 6 interacting protein 1 2 2
MIRT711304 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711513 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711617 LHX5 LIM homeobox 5 2 2
MIRT711647 LIPG lipase G, endothelial type 2 2
MIRT711771 CCDC59 coiled-coil domain containing 59 2 2
MIRT713207 SOCS6 suppressor of cytokine signaling 6 2 2
MIRT715047 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT715620 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT717677 CDC42BPA CDC42 binding protein kinase alpha 2 2
MIRT718016 METTL15 methyltransferase like 15 2 2
MIRT721251 KIAA0922 transmembrane 131 like 2 2
MIRT721438 ARPC4 actin related protein 2/3 complex subunit 4 2 2
MIRT722193 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT723319 PRKCH protein kinase C eta 2 2
MIRT725299 NLRC5 NLR family CARD domain containing 5 2 2
MIRT731866 HDAC8 histone deacetylase 8 3 1
MIRT731987 PARP1 poly(ADP-ribose) polymerase 1 3 1
MIRT735558 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 3 0
MIRT735826 SMAD3 SMAD family member 3 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-216b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-216b 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-216b Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Quantitative real-time PCR human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-216b Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-216b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-216b Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-216b-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216b-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-216b-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HT-29, HCT8)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved sensitive Low Melanoma cell line (A375, G-361)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-216b-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-216b-5p Carboplatin 38904 NSC241240 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, NCI-H460)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549, NCI-H460)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma cell line (MG-63, SaOS-2)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (A2780)
hsa-miR-216b-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-216b-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-216b-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-miR-216b-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-216b-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-216b-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-216b-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-216b-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-216b-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission