>SNX5|NM_014426|3'UTR
   1 TATGCCTTCACTCAGAAGAAAAGAAATGAATGTGAAAGAAAGCCAAGCATCACTTGCACTTAAATCATTACCACGGAAGA
  81 TATATTAGCTTCAACTTTAGTTTAAAATTATGTGAATAAATATTTTGATTTCTACAAATCTTAACATTTAACCATGTTGG
 161 TTTAAAAATATTATTGCTTGCTACTTGGACATAACTAATTTTTCCTTGTGCATTTAATACCTCTGGGCAGAATCCAAATA
 241 CTGGGTTCTCCCGTAGTTCGTCTTTAGTTACTAAGAAAGGGTGTAGGACACATTAGCCTTCTGGAAACAAGTAGAAGCCA
 321 TCACCTGGCCCATGTCCCTACAAACCCATGATTGTCAGGGAGGTGCCAGTTACAGCAGGTGATTCAGCTACTTGAGGTCG
 401 GTAACAGACCTTCCATTCCTCACTGAAGGTGGGGTTTGTGTTTTTGTTTTGCCCTGTTACTCCACTGGTAGTCATCTGGT
 481 GTTTGTACTATAACAACAGCAAGAAAATCTCATTTATCTTTATATACTCTTTGCACCTCCTTTTTTTAGTCGAGATATAA
 561 ATATTTGAGGGGAGAGAAATATCTACAGGTATATATGGAAACAAATAATGTGGTCTGCTTTATAAGATGGCCAGATCTAC
 641 ATTAGGAAAAGTATAAGCCCCCTCCCTAATGGCCGCTGGGGGGTGAGGGCGGTGTGTTGTATGTCTTTGGGTGTTTGTTT
 721 TTTTATAAAGCATATAATAAAATAATCGTGCTACTAATGTAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cggUAGUUUCAAUUUUCGGu 5' | |||: ||:||||| Target 5' ggaAACAAG--TAGAAGCCa 3'	303 - 320	137.00	-11.50
2	miRNA 3' cggUAGUUUCA---AUUUUCGGu 5' || || || :|||||| Target 5' gaaATGAATGTGAAAGAAAGCCa 3'	23 - 45	133.00	-9.10
3	miRNA 3' cgGUAG----UUUCAAUUUUCGGu 5' |||: |||| || ||||| Target 5' taCATTAGGAAAAG-TATAAGCCc 3'	638 - 660	127.00	-9.00

Mutant ID	Mutant Position	Mutant Source
COSN27767446	18	COSMIC
COSN30161846	34	COSMIC
COSN16127832	70	COSMIC
COSN26562281	72	COSMIC
COSN31578686	74	COSMIC
COSN510868	79	COSMIC
COSN30537890	110	COSMIC
COSN4779577	194	COSMIC
COSN20582317	381	COSMIC
COSN10012166	539	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs751335974	3	dbSNP
rs763998462	5	dbSNP
rs1302341672	6	dbSNP
rs1326522762	13	dbSNP
rs762972531	14	dbSNP
rs200970421	17	dbSNP
rs1170088020	18	dbSNP
rs769156235	21	dbSNP
rs759037260	23	dbSNP
rs766948155	26	dbSNP
rs776036588	29	dbSNP
rs371955197	31	dbSNP
rs1204447961	34	dbSNP
rs1336500426	38	dbSNP
rs1482105412	42	dbSNP
rs1284080595	43	dbSNP
rs761318673	43	dbSNP
rs1196584700	44	dbSNP
rs746676277	49	dbSNP
rs554810351	51	dbSNP
rs536739314	52	dbSNP
rs995359763	53	dbSNP
rs1409996009	54	dbSNP
rs779861998	55	dbSNP
rs1291535815	61	dbSNP
rs1487772249	64	dbSNP
rs575555700	67	dbSNP
rs371827386	74	dbSNP
rs557278713	75	dbSNP
rs538165341	83	dbSNP
rs905507675	86	dbSNP
rs142219759	90	dbSNP
rs148718726	98	dbSNP
rs534007104	105	dbSNP
rs1298737959	112	dbSNP
rs757178008	113	dbSNP
rs146534301	123	dbSNP
rs531340560	123	dbSNP
rs370623964	134	dbSNP
rs750091723	137	dbSNP
rs144308630	141	dbSNP
rs943007940	155	dbSNP
rs1314785774	159	dbSNP
rs764131449	160	dbSNP
rs1039309322	161	dbSNP
rs1227432725	161	dbSNP
rs1230082990	162	dbSNP
rs1252333910	176	dbSNP
rs911216203	176	dbSNP
rs984054405	177	dbSNP
rs1196155183	189	dbSNP
rs1244496719	190	dbSNP
rs1461466609	191	dbSNP
rs1182671331	195	dbSNP
rs1411342318	206	dbSNP
rs1335159343	211	dbSNP
rs944947469	221	dbSNP
rs952719088	222	dbSNP
rs1460427547	225	dbSNP
rs918646258	226	dbSNP
rs1285744903	250	dbSNP
rs1242410101	252	dbSNP
rs759475864	253	dbSNP
rs529746738	259	dbSNP
rs960127663	260	dbSNP
rs1437344760	262	dbSNP
rs1384234188	273	dbSNP
rs1296767244	274	dbSNP
rs368804838	274	dbSNP
rs1035551965	275	dbSNP
rs1307402154	277	dbSNP
rs182707782	279	dbSNP
rs751680899	282	dbSNP
rs1386575721	287	dbSNP
rs983421324	290	dbSNP
rs1486662985	292	dbSNP
rs776534036	294	dbSNP
rs1186842922	303	dbSNP
rs1260840524	303	dbSNP
rs1476796471	305	dbSNP
rs970032481	308	dbSNP
rs1021559030	317	dbSNP
rs1011223706	319	dbSNP
rs1429918767	322	dbSNP
rs950686219	338	dbSNP
rs771890587	339	dbSNP
rs973872949	348	dbSNP
rs1357593625	353	dbSNP
rs962598977	358	dbSNP
rs1289784530	360	dbSNP
rs1361783193	361	dbSNP
rs568781721	367	dbSNP
rs1023875289	369	dbSNP
rs1320096935	374	dbSNP
rs1462169346	390	dbSNP
rs550125314	399	dbSNP
rs766470468	400	dbSNP
rs1318332187	408	dbSNP
rs997299785	409	dbSNP
rs1161813233	417	dbSNP
rs6111748	428	dbSNP
rs901337465	429	dbSNP
rs531965047	442	dbSNP
rs1201317282	445	dbSNP
rs1269463295	456	dbSNP
rs1374117869	458	dbSNP
rs1191079596	461	dbSNP
rs1465827275	462	dbSNP
rs763200506	468	dbSNP
rs1423200244	470	dbSNP
rs1402663646	475	dbSNP
rs1207644577	477	dbSNP
rs1160185665	478	dbSNP
rs1451805234	479	dbSNP
rs1305376611	482	dbSNP
rs1366687155	483	dbSNP
rs1291657231	485	dbSNP
rs1272543487	490	dbSNP
rs1436462084	490	dbSNP
rs565263963	490	dbSNP
rs1355445876	491	dbSNP
rs1223863367	493	dbSNP
rs1305760918	498	dbSNP
rs1351090703	502	dbSNP
rs773353395	517	dbSNP
rs1224374493	524	dbSNP
rs540519922	524	dbSNP
rs911437716	526	dbSNP
rs1219363041	527	dbSNP
rs1490156627	527	dbSNP
rs1245043780	530	dbSNP
rs999197260	533	dbSNP
rs1411271978	534	dbSNP
rs902149576	547	dbSNP
rs138735602	548	dbSNP
rs1048642229	551	dbSNP
rs1011052781	552	dbSNP
rs1366628745	554	dbSNP
rs931283455	555	dbSNP
rs528717075	556	dbSNP
rs1322080720	558	dbSNP
rs768591111	559	dbSNP
rs1491406291	560	dbSNP
rs973208165	561	dbSNP
rs191911856	569	dbSNP
rs928448940	578	dbSNP
rs760678044	579	dbSNP
rs1405085636	580	dbSNP
rs1315465166	583	dbSNP
rs1397693482	593	dbSNP
rs775573928	599	dbSNP
rs1170956708	601	dbSNP
rs979925972	602	dbSNP
rs772097411	606	dbSNP
rs969881688	606	dbSNP
rs1205253178	609	dbSNP
rs1021524020	610	dbSNP
rs990095105	611	dbSNP
rs1237703974	612	dbSNP
rs1456588817	623	dbSNP
rs1185735736	624	dbSNP
rs1386106437	634	dbSNP
rs1472634660	637	dbSNP
rs762228171	637	dbSNP
rs944856516	638	dbSNP
rs1390163069	641	dbSNP
rs1169305519	643	dbSNP
rs1397581153	645	dbSNP
rs188249622	647	dbSNP
rs997668549	648	dbSNP
rs1445489293	649	dbSNP
rs920578915	654	dbSNP
rs1217983153	656	dbSNP
rs139589175	657	dbSNP
rs1017776897	659	dbSNP
rs14885	662	dbSNP
rs1205648775	673	dbSNP
rs1007037066	674	dbSNP
rs970538638	675	dbSNP
rs1442080376	683	dbSNP
rs1185835233	684	dbSNP
rs1244233456	685	dbSNP
rs575781578	690	dbSNP
rs889962847	691	dbSNP
rs1422126945	692	dbSNP
rs1470633345	699	dbSNP
rs777068179	707	dbSNP
rs931587892	708	dbSNP
rs1207142763	711	dbSNP
rs1320012387	718	dbSNP
rs897159440	720	dbSNP
rs1399312343	724	dbSNP
rs1339959455	725	dbSNP
rs966388240	725	dbSNP
rs111911412	727	dbSNP
rs1219857253	730	dbSNP
rs1010696503	732	dbSNP
rs1037067912	734	dbSNP
rs545454309	735	dbSNP
rs1273259844	743	dbSNP
rs1193402301	746	dbSNP
rs779222776	746	dbSNP
rs182670803	747	dbSNP
rs558940088	748	dbSNP
rs1376619355	758	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.