>AKR1B10|NM_020299|3'UTR
   1 GGTTGAATCTCCTGGTGAGATTATACAGGAGATTCTCTTTCTTCGCTGAAGTGTGACTACCTCCACTCATGTCCCATTTT
  81 AGCCAAGCTTATTTAAGATCACAGTGAACTTAGTCCTGTTATAGACGAGAATCGAGGTGCTGTTTTAGACATTTATTTCT
 161 GTATGTTCAACTAGGATCAGAATATCACAGAAAAGCATGGCTTGAATAAGGAAATGACAATTTTTTCCACTTATCTGATC
 241 AGAACAAATGTTTATTAAGCATCAGAAACTCTGCCAACACTGAGGATGTAAAGATCAATAAAAAAAATAATAATCATAAC
 321 CAACAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agcUGACGGUG-AGAA--UGAUCu 5' |:| |::: | || ||||| Target 5' tttATTTCTGTATGTTCAACTAGg 3'	152 - 175	110.00	-9.80
2	miRNA 3' agcugaCGGUGAGAAUGAucu 5' |||| ||||:| Target 5' attttaGCCAAGCTTATTtaa 3'	76 - 96	103.00	-10.52
3	miRNA 3' agcUGA--CGGUGAGAAUGAUCu 5' ||| |:| || ||| ||| Target 5' tgaACTTAGTC-CTGTTA-TAGa 3'	105 - 125	103.00	-7.50

Mutant ID	Mutant Position	Mutant Source
COSN14261517	12	COSMIC
COSN30463132	15	COSMIC
COSN20076008	19	COSMIC
COSN31512369	20	COSMIC
COSN30534745	25	COSMIC
COSN30492409	51	COSMIC
COSN30185265	73	COSMIC
COSN31586615	90	COSMIC
COSN30523847	100	COSMIC
COSN31606287	134	COSMIC
COSN31599136	135	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs772724988	2	dbSNP
rs945684921	4	dbSNP
rs760125891	6	dbSNP
rs1440752904	8	dbSNP
rs766015344	12	dbSNP
rs1044357914	14	dbSNP
rs776237038	15	dbSNP
rs1455760608	17	dbSNP
rs1274396854	22	dbSNP
rs1180259161	25	dbSNP
rs759237383	27	dbSNP
rs1208487209	29	dbSNP
rs746099642	30	dbSNP
rs765579784	31	dbSNP
rs753062885	33	dbSNP
rs1028467015	38	dbSNP
rs1181104617	44	dbSNP
rs758882359	45	dbSNP
rs111298187	46	dbSNP
rs751613736	49	dbSNP
rs528077926	51	dbSNP
rs1456198873	52	dbSNP
rs373261293	54	dbSNP
rs1294652037	57	dbSNP
rs1287326798	71	dbSNP
rs1299039503	79	dbSNP
rs1335919811	106	dbSNP
rs1348605966	108	dbSNP
rs1325851266	113	dbSNP
rs547926847	122	dbSNP
rs1008612757	123	dbSNP
rs1157122031	124	dbSNP
rs115843881	127	dbSNP
rs962006556	128	dbSNP
rs993457681	134	dbSNP
rs1481512851	135	dbSNP
rs530555900	141	dbSNP
rs1212970103	147	dbSNP
rs1468894914	151	dbSNP
rs550278522	152	dbSNP
rs1027965881	153	dbSNP
rs1226051930	154	dbSNP
rs951973185	155	dbSNP
rs1307299630	156	dbSNP
rs1225780651	160	dbSNP
rs1365901388	162	dbSNP
rs980583797	163	dbSNP
rs111266417	179	dbSNP
rs1442280959	185	dbSNP
rs1481966857	192	dbSNP
rs1397395272	194	dbSNP
rs926423157	200	dbSNP
rs749217192	206	dbSNP
rs1204111236	207	dbSNP
rs780819038	211	dbSNP
rs960778582	212	dbSNP
rs1431714651	220	dbSNP
rs1393008725	221	dbSNP
rs992198832	224	dbSNP
rs1454611776	226	dbSNP
rs546147908	227	dbSNP
rs1196989681	229	dbSNP
rs1377188451	231	dbSNP
rs570685237	233	dbSNP
rs1206234561	249	dbSNP
rs56375251	251	dbSNP
rs1260851476	255	dbSNP
rs1043710035	257	dbSNP
rs1369176237	269	dbSNP
rs538698441	275	dbSNP
rs1235498335	282	dbSNP
rs1373747866	295	dbSNP
rs1296087094	297	dbSNP
rs74851624	299	dbSNP
rs565285053	300	dbSNP
rs932856358	300	dbSNP
rs891297705	301	dbSNP
rs1375081127	304	dbSNP
rs1309078116	308	dbSNP
rs1435133590	309	dbSNP
rs1396757702	313	dbSNP
rs1190906233	324	dbSNP

- PLoS pathogens, 2012

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus linked to a number of B cell cancers and lymphoproliferative disorders. During latent infection, EBV expresses 25 viral pre-microRNAs (miRNAs) and induces the expression of specific host miRNAs, such as miR-155 and miR-21, which potentially play a role in viral oncogenesis. To date, only a limited number of EBV miRNA targets have been identified; thus, the role of EBV miRNAs in viral pathogenesis and/or lymphomagenesis is not well defined. Here, we used photoactivatable ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) combined with deep sequencing and computational analysis to comprehensively examine the viral and cellular miRNA targetome in EBV strain B95-8-infected lymphoblastoid cell lines (LCLs). We identified 7,827 miRNA-interaction sites in 3,492 cellular 3'UTRs. 531 of these sites contained seed matches to viral miRNAs. 24 PAR-CLIP-identified miRNA:3'UTR interactions were confirmed by reporter assays. Our results reveal that EBV miRNAs predominantly target cellular transcripts during latent infection, thereby manipulating the host environment. Furthermore, targets of EBV miRNAs are involved in multiple cellular processes that are directly relevant to viral infection, including innate immunity, cell survival, and cell proliferation. Finally, we present evidence that myc-regulated host miRNAs from the miR-17/92 cluster can regulate latent viral gene expression. This comprehensive survey of the miRNA targetome in EBV-infected B cells represents a key step towards defining the functions of EBV-encoded miRNAs, and potentially, identifying novel therapeutic targets for EBV-associated malignancies.