pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4747 |
Genomic Coordinates | chr19: 4932687 - 4932740 |
Description | Homo sapiens miR-4747 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4747-5p | ||||||||||||||||||||||||
Sequence | 1| AGGGAAGGAGGCUUGGUCUUAG |22 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MYH14 | ||||||||||||||||||||
Synonyms | DFNA4, DFNA4A, FP17425, MHC16, MYH17, NMHC II-C, NMHC-II-C, PNMHH, myosin | ||||||||||||||||||||
Description | myosin heavy chain 14 | ||||||||||||||||||||
Transcript | NM_001077186 | ||||||||||||||||||||
Other Transcripts | NM_001145809 , NM_024729 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MYH14 | |||||||||||||||||||||
3'UTR of MYH14 (miRNA target sites are highlighted) |
>MYH14|NM_001077186|3'UTR 1 CCCTACCCTGTCCCCAGATGCACTAACAGATGGGGCCCAGCCCCCTTCCTCCCTGGACCCCACGGGCCCCTGTCCCAGGA 81 ACCCCGCCCTCTGACTTCTTGCCCTTTGGAAATGGTGCAGCACTCTGGCATTTATCACCCCCACCTGGGTCCCCTGCAAC 161 CTCCCATCAAAGGATGACCCCTAAACACAGAGGAGCGGGGCAGGCAGGGAGGCAATGACTGGAGCTACCTTGCTTGTTGG 241 GGGACTGGGTACAGTTGGCAAGCTGTGTTTCCATCAGCTCCCTGTCCTCCTTTCTTCCCTCGTTATTGATCTATAGACAT 321 TAGGAAGGGAGTGAGACGGCTCCTCCACCATCCTCAGCCAGTGCAACCCATTCCCTCTGCTTCTCTCTCTCTCTCTCTCT 401 CTCCCTCCCTCTCCTTCCCTACCCTCTCACCATCTTTCTTGGCCTCTCTGAGGGTCTCTCTGTGCATCTTTTTAGGAATC 481 TCGCTCTCACTCTCTACGTAGCCACTCTCCTTCCCCCATTTCTGCGTCCACCCCTGAACTCCTGAGCGACAGAAGCCCCA 561 GGCCTCCACCAGCCTTGAACCCTTGCAAAGGGGCAGGACAAGGGGACCCCTCTCACTCCTGCTGCTGCCCATGCTCTGCC 641 CTCCCTTCTGGTTGCTCTGAGGGTTCGGAGCTTCCCTCTGGGACTAAAGGAGTGTCCTTTACCCTCCCAGCCTCCAGGCT 721 CTGGCAGAAATAAACTCCAACCCGACTGGACCATAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | MCF7 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HCT116 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
PAR-CLIP data was present in SRX1760616. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000601313.1 | 3UTR | UUCUCUCUCUCUCUCUCUCUCUCCCUCCCUCUCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
215 hsa-miR-4747-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT061689 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT062834 | BCL7A | BCL tumor suppressor 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT079371 | CCDC137 | coiled-coil domain containing 137 | ![]() |
![]() |
2 | 2 | ||||||
MIRT081190 | MIDN | midnolin | ![]() |
![]() |
2 | 4 | ||||||
MIRT081724 | ZNF507 | zinc finger protein 507 | ![]() |
![]() |
2 | 2 | ||||||
MIRT110565 | ZMYND11 | zinc finger MYND-type containing 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT133724 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 4 | ||||||
MIRT146689 | MINK1 | misshapen like kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT150676 | SLC27A1 | solute carrier family 27 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT159196 | NRBP1 | nuclear receptor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT180865 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT190659 | PABPN1 | poly(A) binding protein nuclear 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT196111 | MPRIP | myosin phosphatase Rho interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT232390 | SP1 | Sp1 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT331070 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT338632 | SHMT2 | serine hydroxymethyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407441 | CTDSP1 | CTD small phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444276 | NKX6-1 | NK6 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444834 | PDE6D | phosphodiesterase 6D | ![]() |
![]() |
2 | 2 | ||||||
MIRT445452 | EXT1 | exostosin glycosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445644 | NPY4R | neuropeptide Y receptor Y4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446157 | RPL12 | ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446608 | HIP1 | huntingtin interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447108 | CLPX | caseinolytic mitochondrial matrix peptidase chaperone subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT449314 | MRO | maestro | ![]() |
![]() |
2 | 2 | ||||||
MIRT450305 | DRAXIN | dorsal inhibitory axon guidance protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451245 | ZNF444 | zinc finger protein 444 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451714 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451908 | ILK | integrin linked kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452183 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452610 | REPIN1 | replication initiator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453422 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454006 | ALKBH5 | alkB homolog 5, RNA demethylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT455072 | ARHGAP39 | Rho GTPase activating protein 39 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455319 | TTLL9 | tubulin tyrosine ligase like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455357 | KDM5C | lysine demethylase 5C | ![]() |
![]() |
2 | 2 | ||||||
MIRT455589 | TAF12 | TATA-box binding protein associated factor 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455711 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455860 | TMEM254 | transmembrane protein 254 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455919 | RAPGEF1 | Rap guanine nucleotide exchange factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455946 | CYP4A22 | cytochrome P450 family 4 subfamily A member 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456935 | LRP10 | LDL receptor related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457223 | AP3D1 | adaptor related protein complex 3 delta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT457431 | NOL10 | nucleolar protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457470 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457907 | ZNF212 | zinc finger protein 212 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458046 | TSEN54 | tRNA splicing endonuclease subunit 54 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458073 | RNLS | renalase, FAD dependent amine oxidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT458234 | NXPH3 | neurexophilin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458307 | TNFAIP8L3 | TNF alpha induced protein 8 like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458378 | ITM2C | integral membrane protein 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT458967 | ZNF436 | zinc finger protein 436 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459099 | CYP4A11 | cytochrome P450 family 4 subfamily A member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459446 | TMEM37 | transmembrane protein 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459671 | VPS37C | VPS37C, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT460727 | ASXL3 | additional sex combs like 3, transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT460744 | SRP14 | signal recognition particle 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461531 | C14orf1 | ergosterol biosynthesis 28 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT461752 | DDX11 | DEAD/H-box helicase 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461837 | F2RL3 | F2R like thrombin or trypsin receptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462019 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462631 | PHF5A | PHD finger protein 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT462772 | ZNF8 | zinc finger protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463032 | ZNF689 | zinc finger protein 689 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463886 | WNT7B | Wnt family member 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT463995 | WDTC1 | WD and tetratricopeptide repeats 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464371 | URM1 | ubiquitin related modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465342 | TPM3 | tropomyosin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT465515 | PRICKLE4 | prickle planar cell polarity protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465602 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT465697 | TNPO2 | transportin 2 | ![]() |
![]() |
2 | 10 | ||||||
MIRT466988 | SSRP1 | structure specific recognition protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467630 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468132 | SH3PXD2A | SH3 and PX domains 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT468322 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468502 | SESN2 | sestrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468881 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469322 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469562 | RARA | retinoic acid receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT469898 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470045 | PTGFRN | prostaglandin F2 receptor inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT470068 | PTGES2 | prostaglandin E synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470238 | PRRC2A | proline rich coiled-coil 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT470390 | PPP1R16B | protein phosphatase 1 regulatory subunit 16B | ![]() |
![]() |
2 | 2 | ||||||
MIRT470500 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470689 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT470704 | POGK | pogo transposable element derived with KRAB domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT471083 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT472482 | NACC2 | NACC family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473583 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474554 | KLHDC3 | kelch domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474651 | KLF13 | Kruppel like factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474843 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT474934 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475573 | HNRNPC | heterogeneous nuclear ribonucleoprotein C (C1/C2) | ![]() |
![]() |
2 | 2 | ||||||
MIRT476045 | GRSF1 | G-rich RNA sequence binding factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476080 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476440 | GBA2 | glucosylceramidase beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476764 | FOSL2 | FOS like 2, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT478785 | CRTC2 | CREB regulated transcription coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479287 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479505 | CDH6 | cadherin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479732 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT480352 | C5orf24 | chromosome 5 open reading frame 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480407 | C19orf47 | chromosome 19 open reading frame 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480859 | BHLHB9 | basic helix-loop-helix family member b9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481445 | ARRB2 | arrestin beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481732 | APH1A | aph-1 homolog A, gamma-secretase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT481824 | AP2M1 | adaptor related protein complex 2 mu 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT482566 | ABHD2 | abhydrolase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482607 | ABHD14B | abhydrolase domain containing 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT483144 | SYCE1L | synaptonemal complex central element protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT483214 | APOA1 | apolipoprotein A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT483878 | TGIF1 | TGFB induced factor homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483917 | SPSB1 | splA/ryanodine receptor domain and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483939 | LENG8 | leukocyte receptor cluster member 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484420 | SNX19 | sorting nexin 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484489 | SLC9A1 | solute carrier family 9 member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484612 | SIX3 | SIX homeobox 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484705 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485107 | SHISA6 | shisa family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485354 | MYO1C | myosin IC | ![]() |
![]() |
2 | 4 | ||||||
MIRT485609 | FOSL1 | FOS like 1, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT487311 | GLTSCR1 | BRD4 interacting chromatin remodeling complex associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT487417 | CACNB1 | calcium voltage-gated channel auxiliary subunit beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487695 | CDK14 | cyclin dependent kinase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487791 | GPR20 | G protein-coupled receptor 20 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488042 | PABPC1L2B | poly(A) binding protein cytoplasmic 1 like 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT488058 | PABPC1L2A | poly(A) binding protein cytoplasmic 1 like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT488237 | DNLZ | DNL-type zinc finger | ![]() |
![]() |
2 | 4 | ||||||
MIRT488764 | FXYD1 | FXYD domain containing ion transport regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489401 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT489777 | GRINA | glutamate ionotropic receptor NMDA type subunit associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490099 | FN3K | fructosamine 3 kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT490290 | ISL2 | ISL LIM homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490378 | LHFPL3 | LHFPL tetraspan subfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491329 | GFER | growth factor, augmenter of liver regeneration | ![]() |
![]() |
2 | 2 | ||||||
MIRT491435 | MSX2 | msh homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491769 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT491922 | WNK2 | WNK lysine deficient protein kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491983 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492228 | SLC48A1 | solute carrier family 48 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492404 | SDK1 | sidekick cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492767 | PDGFB | platelet derived growth factor subunit B | ![]() |
![]() |
2 | 2 | ||||||
MIRT492966 | NCS1 | neuronal calcium sensor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493295 | LLGL2 | LLGL2, scribble cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT493650 | HDLBP | high density lipoprotein binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT493913 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 4 | ||||||
MIRT495601 | NKX2-5 | NK2 homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496875 | AHCYL2 | adenosylhomocysteinase like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498514 | MYH14 | myosin heavy chain 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499178 | RBPJL | recombination signal binding protein for immunoglobulin kappa J region like | ![]() |
![]() |
2 | 2 | ||||||
MIRT502143 | KIF5B | kinesin family member 5B | ![]() |
![]() |
2 | 8 | ||||||
MIRT502692 | CSNK1G1 | casein kinase 1 gamma 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508460 | HOXB6 | homeobox B6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510430 | ZNF207 | zinc finger protein 207 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511837 | GPATCH8 | G-patch domain containing 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512368 | CPM | carboxypeptidase M | ![]() |
![]() |
2 | 2 | ||||||
MIRT512506 | BTBD19 | BTB domain containing 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513065 | ANKRD45 | ankyrin repeat domain 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513267 | SCUBE1 | signal peptide, CUB domain and EGF like domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT513575 | EVX1 | even-skipped homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515051 | EBNA1BP2 | EBNA1 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515790 | COL4A3BP | collagen type IV alpha 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT521657 | PRKD3 | protein kinase D3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522679 | LUZP1 | leucine zipper protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT528845 | RAB32 | RAB32, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT533569 | TOR1AIP1 | torsin 1A interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543738 | DHCR7 | 7-dehydrocholesterol reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT544295 | TSPYL1 | TSPY like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544857 | MYH2 | myosin heavy chain 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557323 | HIATL1 | major facilitator superfamily domain containing 14B | ![]() |
![]() |
2 | 4 | ||||||
MIRT560522 | TMEM98 | transmembrane protein 98 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561565 | SLC6A9 | solute carrier family 6 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562374 | ERI2 | ERI1 exoribonuclease family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565780 | SEMA6D | semaphorin 6D | ![]() |
![]() |
2 | 2 | ||||||
MIRT569548 | UNC119B | unc-119 lipid binding chaperone B | ![]() |
![]() |
2 | 2 | ||||||
MIRT569944 | PRRT2 | proline rich transmembrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570016 | COL1A2 | collagen type I alpha 2 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT572163 | CRK | CRK proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT572322 | HSPB6 | heat shock protein family B (small) member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573495 | IQSEC3 | IQ motif and Sec7 domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574139 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609449 | CCDC149 | coiled-coil domain containing 149 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610619 | ARHGAP18 | Rho GTPase activating protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623355 | LZIC | leucine zipper and CTNNBIP1 domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT629854 | ACOX1 | acyl-CoA oxidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630516 | CDC73 | cell division cycle 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632535 | PSMB2 | proteasome subunit beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633975 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636408 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT641722 | LTBR | lymphotoxin beta receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT642661 | RGS6 | regulator of G protein signaling 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649649 | MAST3 | microtubule associated serine/threonine kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650367 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651355 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664840 | HUS1 | HUS1 checkpoint clamp component | ![]() |
![]() |
2 | 2 | ||||||
MIRT667322 | MYH9 | myosin heavy chain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670680 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT674922 | TRPM6 | transient receptor potential cation channel subfamily M member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675919 | CYP51A1 | cytochrome P450 family 51 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676493 | GJD3 | gap junction protein delta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680162 | ZDHHC20 | zinc finger DHHC-type containing 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688008 | GSN | gelsolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT688997 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700337 | RAB4A | RAB4A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT701344 | NR4A3 | nuclear receptor subfamily 4 group A member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703519 | FKBP15 | FK506 binding protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703901 | EPT1 | selenoprotein I | ![]() |
![]() |
2 | 2 | ||||||
MIRT705565 | ARHGEF18 | Rho/Rac guanine nucleotide exchange factor 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709709 | DNAJC11 | DnaJ heat shock protein family (Hsp40) member C11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713108 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718426 | ZNF85 | zinc finger protein 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719236 | CYSLTR2 | cysteinyl leukotriene receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719326 | STAC | SH3 and cysteine rich domain | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|